Аппликация мышь: Символ 2020 года своими руками: 401 мышь и крыса в разных техниках рукоделия | Крестик

Содержание

Аппликация «Мышка и норка» (с шаблоном)

  • Аппликации: Животные

                                                                                                                  

    149

  • Объемные аппликации

                                                                                                                  

    135

  • Аппликации с цветами

                                                                                                                  

    57

  • Аппликации: сказочные персонажи

                                                                                                                  

    45

  • Аппликации: Птицы

                                                                                                                  

    41

  • Аппликации на тему лес

                                                                                                                  

    35

  • Аппликации: человек

                                                                                                                  

    26

  • Аппликации: дома и здания

                                                                                                                  

    17

  • Аппликации на тему игрушки

                                                                                                                  

    14

  • Аппликация: море и подводный мир

                                                                                                                  

    14

  • Аппликации: фрукты и овощи

                                                                                                                  

    10

  • Аппликации на тему транспорт

                                                                                                                  

    8

  • поделки в старшую группу детского сада

                                                                                                                  

    543

  • поделки в средней группе детского сада

                                                                                                                  

    537

  • в младшей группе

                                                                                                                  

    494

  • во второй младшей группе

                                                                                                                  

    494

  • в первой младшей группе

                                                                                                                  

    491

  • в подготовительной группе

                                                                                                                  

    447

  • 1 класс

                                                                                                                  

    546

  • 2 класс

                                                                                                                  

    546

  • 3 класс

                                                                                                                  

    546

  • для начальной школы

                                                                                                                  

    531

  • 4 класс

                                                                                                                  

    517

  • 5 класс

                                                                                                                  

    516

  • 6 класс

                                                                                                                  

    455

  • 7 класс

                                                                                                                  

    447

  • 8 класс

                                                                                                                  

    330

  • 9 класс

                                                                                                                  

    206

  • 10 класс

                                                                                                                  

    105

  • 11 класс

                                                                                                                  

    105

  • Домашние животные

                                                                                                                  

    64

  • Птицы

                                                                                                                  

    62

  • Лесные звери

                                                                                                                  

    50

  • Дикие звери

                                                                                                                  

    45

  • Насекомые

                                                                                                                  

    40

  • Морские животные

                                                                                                                  

    28

  • Сказочные животные

                                                                                                                  

    20

  • Лягушки

                                                                                                                  

    5

  • из бумаги

                                                                                                                  

    349

  • из цветной бумаги

                                                                                                                  

    253

  • из картона

                                                                                                                  

    84

  • из бумажных тарелок

                                                                                                                  

    8

  • из салфеток

                                                                                                                  

    7

  • из бумажных стаканчиков

                                                                                                                  

    5

  • маме

                                                                                                                  

    495

  • учительнице/воспитательнице

                                                                                                                  

    492

  • папе

                                                                                                                  

    431

  • девочкам

                                                                                                                  

    71

  • мальчикам

                                                                                                                  

    44

  • для детского сада

                                                                                                                  

    546

  • для школы

                                                                                                                  

    542

  • для дома

                                                                                                                  

    63

  • для кухни

                                                                                                                  

    10

  • Из бумажной продукции

                                                                                                                  

    357

  • Материалы для лепки

                                                                                                                  

    135

  • Из вторсырья

                                                                                                                  

    60

  • из подручных материалов

                                                                                                                  

    40

  • Поделки из природных материалов

                                                                                                                  

    36

  • специальные материалы для поделок

                                                                                                                  

    14

  • Летние поделки

                                                                                                                  

    249

  • Весенние поделки

                                                                                                                  

    218

  • Зимние поделки

                                                                                                                  

    116

  • Осенние поделки

                                                                                                                  

    89

  • для детей 3 лет

                                                                                                                  

    511

  • для детей 5 лет

                                                                                                                  

    433

  • для детей 6 лет

                                                                                                                  

    430

  • для детей 7 лет

                                                                                                                  

    430

  • для детей 8 лет

                                                                                                                  

    427

  • для детей 4 лет

                                                                                                                  

    426

  • для детей 9 лет

                                                                                                                  

    423

  • для детей 10 лет

                                                                                                                  

    414

  • для детей 11 лет

                                                                                                                  

    396

  • для детей 12 лет

                                                                                                                  

    375

  • для детей 13 лет

                                                                                                                  

    240

  • для детей 14 лет

                                                                                                                  

    195

  • для детей 2 лет

                                                                                                                  

    194

  • для детей старше 14 лет

                                                                                                                  

    171

  • для детей 1 года

                                                                                                                  

    29

  • на День рождения

                                                                                                                  

    290

  • ко Дню матери

                                                                                                                  

    246

  • Поделки ко Дню учителя и воспитателя

                                                                                                                  

    185

  • на 8 марта

                                                                                                                  

    143

  • на Новый год 2021

                                                                                                                  

    94

  • на Осенний бал

                                                                                                                  

    38

  • на 14 февраля

                                                                                                                  

    36

  • на Китайский Новый год

                                                                                                                  

    31

  • к 23 февраля

                                                                                                                  

    28

  • на Пасху

                                                                                                                  

    22

  • к Хеллоуину

                                                                                                                  

    22

  • к 1 мая

                                                                                                                  

    21

  • ко Дню космонавтики

                                                                                                                  

    17

  • к 9 мая

                                                                                                                  

    9

  • к 1 сентября / ко Дню знаний

                                                                                                                  

    3

  • Животные и звери

                                                                                                                  

    250

  • Растения

                                                                                                                  

    71

  • по сказкам и мультикам

                                                                                                                  

    61

  • Сказочные персонажи

                                                                                                                  

    58

  • Игрушки

                                                                                                                  

    45

  • Еда

                                                                                                                  

    41

  • Новогодние

                                                                                                                  

    35

  • Деревья

                                                                                                                  

    33

  • Поделки на морскую тему

                                                                                                                  

    33

  • Дома и здания

                                                                                                                  

    28

  • по книгам

                                                                                                                  

    28

  • Человек

                                                                                                                  

    26

  • Сердечки

                                                                                                                  

    12

  • Транспорт

                                                                                                                  

    12

  • Космос

                                                                                                                  

    8

  • Погода

                                                                                                                  

    6

  • Одежда

                                                                                                                  

    6

  • Грибы

                                                                                                                  

    6

  • Подбор поделок по возрасту ребенка

                                                                                                                  

    548

  • Куда

                                                                                                                  

    548

  • Материалы для поделок

                                                                                                                  

    540

  • Типы и виды поделок

                                                                                                                  

    521

  • Кому

                                                                                                                  

    520

  • Поделки на праздники, к датам и событиям

                                                                                                                  

    458

  • Поделки по темам

                                                                                                                  

    431

  • по временам года

                                                                                                                  

    375

  • С шаблоном

                                                                                                                  

    238

  • Распечатки

                                                                                                                  

    50

  • Аппликации

                                                                                                                  

    362

  • Игрушки

                                                                                                                  

    132

  • открытки

                                                                                                                  

    97

  • Пластилинография

                                                                                                                  

    65

  • Лепка

                                                                                                                  

    27

  • Книжка своими руками

                                                                                                                  

    12

  • Диорамы

                                                                                                                  

    10

  • Гирлянды своими руками

                                                                                                                  

    10

  • Адвент календари

                                                                                                                  

    9

  • Украшения

                                                                                                                  

    7

  • Маски и костюмы

                                                                                                                  

    6

  • Оригами

                                                                                                                  

    5

  • Закладки

                                                                                                                  

    5

  • Венок

                                                                                                                  

    4

  • Рамки для фотографий своими руками

                                                                                                                  

    2

  • Как сделать мышку из бумаги своими руками поэтапные мастер классы

    Символом наступившего нового 2020 года является крыса, поэтому поделки этого зверька или приближенного сородича — мышки — сейчас особенно актуальны. Сделать игрушку можно различными техниками работы с бумагой. Любые поделки можно изменять по-своему усмотрению, добавляя аксессуары и дополнительные детали.

    Поделки мышки можно изготовить множеством способов работы с бумагой

    Мышка в стиле оригами

    Перед тем как сделать мышку из бумаги в стиле оригами, сначала стоит потренироваться в сборке поделки на простом тетрадном листе.

    Цвет основы можно выбрать самостоятельно, из множества вариантов. А чтобы разукрасить мордочку рекомендуется использовать фломастеры или гелиевую ручку.

    Игрушки оригами очень популярны и просты в изготовлении

    Пошаговая инструкция создания мышонка техникой оригами:

    • Взять идеально квадратный лист плотной цветной бумаги и согнуть его по диагонали.
    • Разогнуть в прежнее положение и согнуть углы к линии сгиба, что образовалась посередине.
    • Сделать подобные сгибы с другой стороны поделки.
    • Теперь необходимо расправить с одной стороны нижний край и сделать обратный сгиб, как показано на рисунке ниже. Повторить те же манипуляции с обратной стороны.

    Чтобы сделать обратный сгиб, необходимо расправить один из углов

    Продолжать следует так:

    • Получившиеся уголки необходимо согнуть вверх. При этом края должны быть параллельны средней линии фигурки.
    • Уголок, что лежит поверх другого, следует загнуть в обратную сторону.
    • Верхний угол изделия согнуть на треть в нижнему углу. Теперь расправить и согнуть его таким способом в обратную сторону.
    • Перевернуть поделку на другую сторону и загнуть тупые углы вниз.
    • Согнуть бумажное изделие вдоль длины вовнутрь.
    • Чтобы сделать будущему мышонку хвостик, необходимо согнуть нижний острый угол вниз, как показано ниже на рисунке.

    Будущий хвостик мышонка формируется следующим образом

    Осталось всего несколько действий:

    • Теперь отогнуть кончик того же угла в обратную сторону, чтобы добиться зигзагообразной формы.
    • Нижние выступающие у будущего хвостика углы завернуть в обратную сторону.
    • Чтобы сформировать ушки, следует отогнуть верхние углы в заднюю сторону.
    • Последний штрих — разрисовать мордочку зверька.

    Обратите внимание! Чтобы придать поделке более милый вид, можно слегка расправить у оригами ушки.

    Аппликация мышка из цветной бумаги

    Аппликации помогают развивать воображение малышей, поэтому нередко используются для детского творчества. Сделать мышку из цветной бумаги техникой аппликация можно несколькими способами, которые представлены ниже.

    Аппликация мышонка с сыром

    Первая аппликация делается так:

    1. Вырезать каплевидный полукруг и отрезать его верхушку.
    2. Затем из той же бумаги сделать острый треугольник и два полуовальных ушка.
    3. Из розовой бумаги вырезать полуовалы чуть меньшего размера и небольшие удлиненные лапки.
    4. Отдельно из желтой бумаги сделать треугольный сыр с дырочками.
    5. Для хвостика можно взять кусочек шерстяной нитки.
    6. Сыр приклеить сбоку посередине туловища, у внутреннего угла лакомства прикрепить лапку с коготочками.
    7. На треугольной мордочке сделать глазки и носик, а сзади ушки.
    8. Зафиксировать голову наверху туловища.
    9. Приделать лапки и хвостик.

    Вариант поделки для украшения праздничных открыток

    Следующая аппликация — мышка из цветной бумаги, идеально подойдет для украшения поздравительной открытки для мальчика или девочки.

    1. Вырезать желтый квадрат, сложить его по диагонали и сделать на одной стороне несколько маленьких дырочек.
    2. Из серой цветной бумаги вырезать удлиненный треугольник с острым углом.
    3. По его краям сделать одинаковые надрезы и пририсовать к их окончаниям коготки.
    4. Вверх треугольника согнуть вниз и приклеить сзади ушки, а спереди глаза, усики и носик.
    5. Сделать надрез по сгибу в диагонали сыра и вдеть туда мышонка, высунув его лапки.
    6. Приклеить аппликацию к открытке или на лист бумаги.

    Варианты мышек из картона

    Поделки из картона прослужат намного дольше

    Своими руками мышку из бумаги можно сделать даже за очень короткий промежуток времени. Процесс изготовления изделия увлекателен для творческой работы с ребенком.

    Внимание! Чтобы игрушка прослужила дольше и не теряла своей формы, лучше выполнить ее из картона.

    Изготавливается эта быстрая и легкая в исполнении бумажная игрушка, следующим образом:

    • Вырезать из картона полоску в 5 сантиметров в ширину и около 30 в длину.
    • Лицевой стороной наружу склеить концы, чтобы верхний край на 1 сантиметр выпирал вперед.

    Угол станет мордочкой будущего бумажного зверька

    Далее делают так:

    • Конец склейки нужно срезать, образовав угол, который будет представлять мордочку мышонка.
    • Из белой бумаги вырезать два круга диаметром от 3 до 4 сантиметров. Еще два кружочка меньшего размера приготовить из картона, который использовался для создания туловища игрушки. Приклеить их друг к другу.
    • Загнуть края глазок и приклеить их к туловищу, чтобы они стояли.
    • К противоположной стороне приклеить полоску картона, сформировав хвостик.

    Овальная коробочка придаст картонной поделке более милый вид

    Из картона можно сделать коробочку для мелочей сдекорариованной в виде мышки. Можно использовать готовую коробочку или собрать ее самостоятельно.

    Лучше всего, если она будет иметь овальную форму. Нужно приклеить на одну половину ее крышечки глазки, носик, усики и ушки. Также с той стороны мило будут выглядеть свисающие лапки.

    С другой стороны, приделать тонкий хвостик. Малышам точно понравится возиться с такой поделкой и хранить в ней свои мелкие безделушки.

    Объёмные мышата из цветной бумаги

    Объемные мышата заменят детям игрушки

    Для того, чтобы сделать из бумаги объемную мышку, лучше всего заранее распечатать готовую выкройку. Более опытные мастера могут сделать игрушку, сверяя ее детали на глаз. Мастер-класс, как сделать мышь из бумаги в объемном формате представлен ниже.

    Сначала необходимо заготовить детальки мышки, по приведенной ниже на картинке схеме.

    Выкройка для одного из вариантов изготовления объемных мышат

    Далее действуют так:

    1. Самая большая деталь должна быть яркого цвета, так как она в последующем будет платьицем мышонка. Основные детали можно сделать белого, серого или черного цветов, а внутреннюю сторону уха — розового.
    2. К одной из деталей головы необходимо приделать глазки и носик.
    3. Приклеить розовые детали ушек к основным большим частям. Затем прикрепить их к другой детали головы, а сверху приклеить часть с носиком и глазками.
    4. Сделать конус из самой большой из выкроек и прикрепить на ее кончик голову мышки.
    5. Приклеить лапки мышонка к туловищу, а сзади прикрепить хвостик.

    Объемного мышонка можно сделать из обычной цветной бумаги или картона

    Еще один способ сделать мышь из бумаги своими руками:

    • Взять желтый или оранжевый картон и вырезать из него большой круг диаметром в 15 сантиметров. Он изобразит сыр, из которого будет выглядывать головка мышонка.
    • Вырезать полосу из серого картона в 20 сантиметров в длину и 5 см в высоту.
    • Сделать прямой сгиб на 1,5 сантиметра с одного конца края.
    • Затем другой край просунуть в получившийся сгиб и приклеить. Получится фигурка похожая на каплю.
    • Приклеить получившуюся фигуру одним краем у острого угла на подставку-сыр.

    К круглому «сыру» нужно приклеить только одну сторону фигуры

    Далее все просто:

    • Вырезать из серого картона три круга: один большой для головы и два маленьких для ушек.
    • На ушки приклеить меньшие по размеру кружочки розового цвета. Затем прикрепить их к задней части круглой бумажной головы.
    • Сделать глазки из белого и черного картона, тонкие усики и круглый носик. Прикрепить все части к мордочке изделия.
    • Зафиксировать голову на каплевидной форме туловища.

    Можно приделать лапки и хвостик серого цвета на основании игрушки, тогда получится миниатюрный мышонок, стоящий на круглой головке сыра.

    Добавив лапки и хвостик, можно сделать маленького милого мышонка

    Обратите внимание! Чтобы сделать мордочку мышки еще более выразительней, лучше приобрести специальные готовые глазки для поделок из магазина.

    Симпатичного объемного мышонка можно сделать из втулки туалетной бумаги:

    1. Обклеить внешнюю поверхность втулки цветной бумагой.
    2. Вырезать из картона круглые ушки, внутри которых приклеить или нарисовать розовые кружочки.
    3. Сзади приделать хвостик, а спереди лапки.
    4. Разрисовать мордочку зверька.

    Глазки игрушки можно сделать из цветной бумаги или приклеить детали старых игрушек. Для более объемного вида усики рекомендуется делать из тонких полосок картона.

    Чем шире втулка, тем более симпатичным получится мышонок

    Бумажные мышки на елку

    Отличной идеей станет оформление новогодней елки разноцветными бумажными мышатами. Перед тем как начать собирать игрушку, следует вырезать необходимые детали:

    • овал для туловища;
    • сердцеобразную головку, продолжение которой — это два округлых ушка;
    • вытянутые небольшие лапки;
    • круглая деталь с удлиненной по касательной задней лапкой.

    Маленькие разноцветные мышата украсят любую новогоднюю клетку

    Пошаговый процесс изготовления бумажных елочных украшений:

    1. Согнуть туловище-овал и голову дугой. Перед этим, ушки следует согнуть вперед.
    2. Приклеить края головки в верхней части тельца зверька.
    3. Закрепить на мордочке глазки и носик, а к туловищу приклеить верхние лапки.
    4. К нижним краям туловища закрепить полукруг с задней лапкой.
    5. Сзади приклеить хвостик, край которого можно выкрутить ножницами. Крепить ленточку лучше всего к верхнему основанию туловища.

    Бумажная мордочка мышки с новогодней шапочкой

    Еще один вариант — сделать мордочку мышки с новогодней шапочкой:

    1. Вырезать два полукруга для ушек и приклеить к ним розовые кружочки.
    2. Вырезать два пятиугольника, к одному из них приклеить ушки и расположить сверху ленточку. Сверху плотно приклеить другую часть головы.
    3. Закрепить усики, глазки и носик.
    4. Сверху приклеить красную треугольную шляпку с белым помпоном.

    Мышки из белой бумаги

    Из обычной белой бумаги для печати можно сделать маску, которая бывает разных вариантов: на все лицо или только в половину.

    Чтобы сделать карнавальную маску в пол лица понадобятся обычная белоснежная плотная бумага, ножницы, клей и резинка. Вместо эластичной ленты можно взять обычный шнурок, однако в этом случае велика вероятность, что готовое изделие будет соскальзывать с головы.

    Обычная белая бумага тоже подойдет для различных поделок

    Поэтапная инструкция изготовления маски:

    1. Нарисовать верхнюю половину мордочки мышки на обратной стороне бумаги. Вырезать в них отверстия для глаз.
    2. Ушки вырезать отдельно. Из розовой бумаги необходимо сделать внутреннюю часть ушей.
    3. Из черной цветной бумаги вырезать небольшой круглый носик и тонкие полоски для усиков.
    4. Приклеить носик к морде и две детали уха друг к другу. К краю мордочки прикрепить усики.
    5. Прикрепить ленточку или резинку и поделка готова.

    Обратите внимание! Новичкам и детям лучше распечатать готовый шаблон масок, подгоняя по желаемому размеру.

    Бумажных зверьков можно изготовить разными способами

    Бумажных мышат можно сделать множеством различных способов. Все они имеют свою изюминку и изготавливаются из подручных материалов, которые находятся в шаговой доступности.

    10 вариантов как сделать бумажную мышь (крысу) пошагово мк с фото

    Здесь представлены самые разные мастер-классы — как сделать мышку из бумаги своими руками с пошаговыми фотографиями. Некоторые недолюбливают этого грызуна, но мы постараемся изменить отношение к мышкам, которые могут быть вполне милыми. Например, в наших мастер-классах показан процесс изготовления самых безобидных и симпатичных мышек из бумаги.

    Как сделать мышку из бумаги

    Серая мышка из бумаги

    Работу над созданием этой поделки можно начать с загадки. Например, попробуйте спросить своего ребенка: «Кто живет в норке и грызет корки?» Наверняка, ответ будет правильным: «Это мышка». А сделать ее мы предлагаем из цветной бумаги по нашему мастер-классу.

    Для создания такой мышки мы приготовили:

    • бумагу серого, розового и белого цвета;
    • ножницы;
    • линейку;
    • пластмассовые глазки;
    • клей.

    Нашу мышку мы будем делать из бумаги серого цвета. Для этого от листа бумаги отрезаем полоску шириной 6 см, а длиной 18 см. При желании эта поделка может иметь и другие размеры. Главное, чтобы заготовка имела форму вытянутого прямоугольника

    Теперь воспользуемся клеем и соединим противоположные края этого прямоугольника. Но место сгиба не заглаживаем, в этом месте заготовка должна остаться объемной. В итоге получаем тело будущей мышки.

    А далее мы займемся деталями нашей поделки. Для ушек вырежем из серой бумаги пару кружков.

    Середину их оформим розовыми кругами меньшего размера.

    Приклеиваем эти ушки к основе мышки.

    Из белой бумаги вырежем усики, по обеим сторонам сделаем частые надрезы ножницами.

    Приклеиваем усики нашей мышке.

    Носик сделаем из небольшого кружочка, вырезанного из розовой бумаги.

    Добавляем глазки. Нашем случае они пластмассовые, но при отсутствии таких можно нарисовать глазки на белой бумаге, а потом приклеить.

    Осталось сделать хвостик, его мы вырезаем из серой бумаги.

    Фиксируем хвостик с помощью клея сзади и снизу поделки.

    Наша серая мышка из бумаги готова.

    Бумажная мышь своими руками легко и просто

    Мышка из бумаги в сыре

    Что ваш ребенок знает о мышках? Наверняка, ему известно, что данные грызуны любят сыр. Поэтому мы предлагаем сделать соответствующую поделку по нашему мастер-классу.

    Закладка для книг в виде мышки

    Мы предлагаем сделать поделку из бумаги, которая будет иметь практическое предназначение – закладку для книг в виде белой мышки. А подробный процесс ее изготовления показан в данном мастер-классе.

    Яркая аппликация из бумаги с изображением мышки

    На предложенной в этом уроке новогодней аппликации изображена желтая мышка в виде Снегурочки. Такая поделка актуальна, ее можно сделать перед каникулами или во время праздников, чтобы передать новогоднее настроение, или смастерить подарок для родителей, бабушек и дедушек.

    Для создания яркой аппликации подготовьте:

    • красный картон;
    • зеленую, голубую, белую и желтую бумагу;
    • ножницы;
    • клей;
    • кусочки глиттерного фоамирана или серебристые нити;
    • красивые белые или перламутровые полубусинки, имитирующие снежинки.

    Как сделать аппликацию с мышкой из бумаги поэтапно

    Подготовьте для работы плотное основание. Используйте картон. На красном фоне ярко будет смотреться и елочка, и мышка Снегурочка.

    Из зеленой бумаги вырежьте елочку, предварительно с обратной стороны нарисовав ее эскиз. Можно сделать веточки разноформатными, чтобы модель получилась интересной. Наклейте елочку в верхнем углу рисунка.

    Из желтой, голубой и белой бумаги вырежьте заготовки для мышки. Видна будет только ее голова с ушами. Вырежьте капельку и 2 круглые детали. Туловище же будет одето в костюм Снегурочки. Подготовьте трапециевидную деталь для шубки, продолговатые заготовки для рукавов, а также вырежьте варежки и ботинки из бумаги того же цвета. Еще подготовьте овальные белые детали для имитации меховой опушки. Не забудьте, что у Снегурочки еще должна быть на голове шапка в том же стиле.

    Склейте между собой детали, сделайте шубку, шапку и голову.

    Соберите фигурку мышки и наклейте ее на аппликацию в нижней части. Добавьте на мордочку глаз и носик, нарисуйте рот. Из яркого глиттерного фоамирана вырежьте звездочку и прикрепите на верхушку елки либо используйте стразы.

    Останется лишь украсить елочку сверкающим серпантином, прикрепив тонкие полоски, распределить по всей аппликации снежинки из бумаги.

    Интересная аппликация с изображением мышки к Новому году готова.

    Интересная сумочка оригами в виде мышки

    Если вы хотите красиво упаковать подарок – маленький презент, то можете сделать небольшую сумочку. Задействуйте для этого технику оригами.  Мастер-класс здесь.

    Белые бумажные мышки на сыре

    В этом мастер-классе мы покажем процесс создания белых мышек на сыре.

    Весёлая бумажная мышка своими руками

    В этом мастер-классе показан процесс изготовления весёлой мышки из бумаги.

    Сердечный мышонок — мастер-класс

    Эта бумажная мышка делается очень быстро и просто, но получается очень оригинальной. Мастер-класс здесь.

    Как сделать мышки в технике оригами из бумаги

    Как сделать такие мышки оригами пошаговые мастер-классы смотрит здесь.

    Поделка из втулки

    Бумажная мышь — поделка для детей

    Советуем посмотреть как сделать лизуна и цветы из бумаги.

    Как сделать мышку из бумаги свои руками: простые и сложные DIY


    Автор Olga На чтение 5 мин. Просмотров 3.6k.
    Обновлено

    Мы делаем мышек из бумаги к разным событиям (Новый год, Пасха, Хэллоуин)  и просто так — для забавы с детьми. Вдохновляйтесь нашей подборкой идей и мастер-классов.

    Игрушка-качалка Мыши на сыре

    Уровень сложности: средний.

    Забавная игрушка, в которую может играть малыш — она качается!

    Материалы

    Потребуется плотная цветная бумага, упаковочный картон (толстенький), черный фломастер, клей ПВА.

    Инструкция

    С помощью циркуля или трафарета (блюдце, тарелочка) вырезаем несколько кругов из картона и один круг из желтой бумаги. Диаметр примерно 12-14 см. Разрезаем каждый круг по диагонали. Картонные круги склеиваем между собой, чтобы получился полукруг «кусок сыра». Оставляем без клея зазор между картонками в середине.

    Рисуем простейшую фигурку мыши. Отдельно тело, голова 2 ушка, 2 лапки. Склеиваем детали. Тело вставляем в середину «сыра», предварительно смазав клеем. Обклеиваем картонную деталь желтой бумагой и рисуем фломастером «дырочки на сыре». Более детально смотрите в видео: 

    Если сделать много разноцветных мышек — можно украсить ими елку, подоконник. Научите ребенка складывать бумажную фигурку — это полезное занятие для развития мелкой моторики.

    Мышь из модулей оригами

    Уровень сложности: средний.

    Материалы

    Чтобы собрать такую пузатенькую мышь потребуется: 20 маленьких пикселей (модулей), 120 больших и 4 розовых пикселя для лапок.

    Схема сборки одного пикселя:

    Подробная инструкция по сборке мыши из готовых модулей показана в видео:

    Плоская мышь в технике аппликация

    Источник: https://www.dltk-kids.com/

    Уровень сложности: просто.

    Простая поделка мышь из бумаги. Вам потребуется только распечатать шаблон или перерисовать его с экрана. Далее детали надо раскрасить любыми материалами и склеить между собой. Данный проект подойдет для творчества с маленькими детьми и как поделка в детский сад.

    Инструкция:

    1. Распечатайте шаблон мыши и раскрасьте (где уместно).
    2. Вырежьте детали шаблона — родители могут помочь вырезать более сложные детали, такие как хвост, в то время как дети работают над более легкими элементами, такими как тело и ноги.

    Соберите мышь в следующем порядке:

    1. Склейте ноги позади тела.
    2. Приклейте руки к телу.
    3. Приклейте сыр в одну из лапок.
    4. Приклеить голову поверх тела.
    5. Приклеить уши к голове.
    6. Смотрите рисунок на шаблоне для помощи.

    Яркие мышки из бумаги

    Источник: https://www.thelittlecrafties.com/

    Уровень сложности: просто.

    Объемная мышка из простых фигур: полоска, круг, сердечко.

    Материалы

    Потребуется цветная плотная бумага, циркуль, клей.

    Инструкция

    Вырежьте 2 круга радиусом 3 см., бумажную полоску размером 1 см X 12 см. Сложите круги пополам. Вырежьте из одного круга сердце.

    Сложите верхушку сердца, чтобы сделать уши бумажной мышке. Нарисуйте глаза и рот как на фото. Вставьте другой круг в мордочку, чтобы сделать тело мыши. Сверните бумажную полоску и прикрепите, чтобы сделать хвост.

    Летучая мышь оригами

    Уровень сложности: средний.

    Если сделать много таких черный мышей, то можно собрать  из них гирлянду, прикрепив мышек к шпагату. Чем не декор на Хэллоуин?

    Летучая мышь хлопает крыльями

    Уровень сложности: средний.

    Особенность этой фигурки оригами — она умеет махать крыльями! Потребуется один прямоугольный лист бумаги (А4).

    Валентинка Мышь с сердечками

    Источник: https://www.thecrafttrain.com/

    Уровень сложности: просто.

    Секрет успеха этой открытки-валентинки в том, что милая мышь содержит 7 сердечек! Посчитайте, все нашли? Мордочка мыши не приклеена полностью к основанию, что создает 3D эффект.

    Материалы

    Основание для открытки (скрап бумага, или бумага для пастели, или не толстый картон).

    Бумага для основных деталей мыши и контрастная бумага для 4-х сердечек (смотрите фото).

    Инструкция

    Перерисуйте с экрана шаблон мыши на лист бумаги, и 4 сердечка контрастного цвета. Вырежьте все детали. Соберите все детали с помощью клея на открытке. нарисуйте глазки.

    Мышь-закладка из бумаги

    Источник: https://www.crafts-beautiful.com/

    Уровень сложности: просто.

    Для любителей чтения хороший подарок: креативная мышь-закладка. А можно сделать такую закладку для своих учебников.

    Из декоративной бумаги вырезать полукруг и свернуть его пополам. Склеить по краю среза-радиуса. Из однотонной бумаги вырезать 2 ушка в форме капелек, усики — 3 полосочки. Приклеить ушки к верхней части закладки, а усики — к нижней.

    Нарисовать глаза. Вклеить джутовый шнурок, это будет хвостик. В качестве носика приклеить красную бусину или пуговку. Она такая милая, правда?

    Если под рукой нет красивой поделочной бумаги, а закладка нужна прямо сейчас — сделайте быструю закладку в технике оригами из обычного листа белой бумаги:

    Мышь из готовой раскладки

    Уровень сложности: сложно.

    Объемная мышь из бумаги стоит на своих лапках. Чтобы сделать такую фигурку, скачайте к себе файл раскладки:

    Распечатайте на принтере, можно раскрасить. Аккуратно соберите, последовательно склеивая детали. Процесс сборки показан на раскладке.

    Мышь-коробочка своими руками

    Источник: https://www.crafts-beautiful.com/

    Уровень сложности: средний.

    В такую коробочку можно положить подарочек, например, маленькую шоколадку.

    Распечатайте шаблон на декоративной плотной бумаге. Вы можете масштабировать раскладку в зависимости от того, какой размер коробочки нужен.

    Усики и ушки должны быть контрастного цвета. Хвостик — из узкой атласной тесьмы.

    Согните раскладку по сгибам, соберите фигурку, склейте. Заднюю часть не надо приклеивать. Приклейте 2 черные бисерины — глаза, ушки, хвост, пуговку на носик, усики — снизу коробочки. Положите внутрь подарочек. Готово!

    Мышь из папье-маше

    Уровень сложности: сложно.

    Мышь из папье-маше может быть маленькой, как в первом видео, так и большой — как во втором. Но в обоих случаях потребуется время и терпение, так как процесс создания фигурки из бумаги и клея кропотливый. В видео предлагается сделать диснеевских мышат. 

    Маленький Микки-Маус из проволоки и папье-маше в видео уроке:

    Большая Минни-Маус из папье-маше:

    Конспект занятия «Осень касается листьев рукою». Аппликация из листьев. «Мышка».

    «Осень касается листьев рукою».

    Аппликация из листьев. «Мышка».

    (Технология — Накладная аппликация).

    Воспитатель I кв. категории

    В.Н. Машнёва.

    Цель: Научить составлять композиции из засушенных листьев.

    Задачи:

    Развивать навыки работы с природным материалом.

    Развивать воображение, чувство формы, восприятие цвета.

    Воспитывать аккуратность.

    Воспитывать умение доводить начатое дело до конца.

    Коррекционные задачи:

    Учить выполнять аппликацию из осенних листьев.

    Развивать слуховое внимание, зрительную память, мелкую моторику, совершенствовать умение работать в технологической последовательности изготовления аппликации.

    Активизировать словарный запас; развивать фразовую речь.

    Воспитывать аккуратность, терпение, эстетический вкус.

    Предварительная работа:

    Экскурсии в парк, сбор осенних листьев, просмотр осенних кинозарисовок, работа с «Календарём природы и труда», наблюдения за изменением природы, за явлениями природы: листопад, положением солнца, состоянием погоды, чтение рассказов В. Бианки, аппликации из осенних листьев.

    Оборудование: для воспитателя —  иллюстрации к сказкам «Репка», «Курочка  ряба», образец  аппликации, для детей —  засушенные листья, клей, картон, ножницы.

    Ход занятия

    1.Организационный момент

    Коррекция осанки.

    II Введение в урок.

    Работа с уголком «Календарь природы и труда»

    — Какое сегодня число, месяц? день недели? (10 сентября, воскресенье)

    — Какое число было вчера, (9 сентября, суббота)

    — Какое число будет завтра? (11 сентября, понедельник)

    — Ребята, а какое время года сейчас? ( Осень)

    — Какие явления природы мы наблюдаем осенью? (Постепенно холодает, короче становятся дни, меняют окраску листья, листопад,  часто идут дожди, птицы собираются в стаи и улетают в тёплые края)

    Воспитатель. Правильно, ребята!

    Осень – чудесное время! Как из красивой сказки приходит к нам царица Осень! Украшает деревья яркими бусами, меняет окраску листьям. Теперь они не только зеленые, но и желтые, оранжевые, красные, коричневые! Топнула Осень своим багряным сапожком, тряхнула своими золотыми кудрями, и посыпалось золото с деревьев. Укрыла осень разноцветным ковром землю, нашу кормилицу.

    Ребята, посмотрите, как осень украсила наш класс! Мы с вами собирали осенние букеты, делали поделки из листьев.

    Актуализация знаний учащихся.

    Воспитатель. Мы с вами на прогулках собрали много листьев.  

    — Вы видели, как падают листья с деревьев? (Да)
    — Как называется это явление природы? (Листопад.)
    Воспитатель. Посмотрите они лежат у вас на партах.

    — Одинаковые ли они? (Нет)
    — А чем они отличаются? (Цветом, формой, размером.)
    — Какие листья бывают по форме? Покажите мне листики: круглые, овальные, треугольные, с пальчиками, с зубчиками, с волнами.

    Физминутка «Мы листики осенние».

    Мы листики осенние,
    На ветках мы сидим.
    Дунул ветер – полетели.
    Мы летели, мы летели.
    И на землю тихо сели.
    Ветер снова набежал.
    И листочки все поднял.
    Закружились , полетели
    И на землю тихо сели.

    Воспитатель. Правильно. Листья разные не только по цвету и по форме, они от разных деревьев.

    Сейчас мы с вами немного поиграем:

    Дидактическое упражнение «Угадай, с какого дерева лист».

    Цель: закрепить знания детей о природе родного края, закрепить умение образовывать относительные прилагательные (береза – березовый, дуб – дубовый и т. д.)

    Материал: Картинки и иллюстрации с изображением деревьев и кустарников и листьев

    Ход игры: Воспитатель показывает картинки с изображением листка, затем дерева.

    Воспитатель. Вот и сегодня мы с вами выполним аппликацию животного. А какого вы узнаете, отгадав загадку.

    Живёт в норке,

    Грызёт корки.

    Небольшие ножки,

    Боится кошки.(Мышь. )

    Воспитатель. Правильно, это мышь. Вот о ней мы сегодня и поговорим. Хоть она маленькая, но без неё трудно  обойтись в сказках.

    2.  Ориентировка в задании.

    Вопросы:

    — Вспомните, героиней, каких сказок была мышка. (С опорой на иллюстрации — «Теремок», «Репка», « Курочка ряба» и др.)

    — В каких из этих сказок  мышка была главным  действующим  лицом? Почему?(«Репка», и «Курочка ряба»)

    3.  Изучение техники изготовления мышки.

    Воспитатель. Для изготовления мышки можно использовать листья берёзы, осины. Кроме этого вы должны решить для себя, мышку из какой сказки будете делать. Если из сказки «Репка», то рядом с мышкой должен быть предмет, подсказывающий это. Например репка, сделанная из листьев. Если из сказки «Курочка ряба», то рядом поместить аппликацию разбитого яйца.

    а) Анализ образца: (Вывешиваю образец)

    — Посмотрите внимательно на образец! Что изображено на аппликации?

    — В какой технике выполнена работа? ( Аппликация)

    — Из каких материалов выполнена аппликация? ( Из картона, бумаги, листьев и клея)

    — Из каких деталей состоит наша аппликация? Из основы, листьев, рамки (паспарту).

    б) Последовательность действий:

    а) Нанести контур туловища мышки карандашом по размеру листа. Наклеить лапки. Мышка располагается по центру основы.

    б) Наклеить туловище.

    в) Прикрепить голову, ушки. Хвост, глаз, и нос дорисовать фломастером.

    в)  Организация рабочего места.

    а) Повторение правил по ТБ при работе с ножницами, клеем.

    б) Проверка наличия подсобного материала, инструментов: клей, кисть, салфетка, сухие листья, картон для основы.

    4. Практическая работа

    а) Нанести контур туловища на основу и наклеить мелкие детали.

    б) Приклеить туловище и голову с ушами. Хвост и глаз нарисовать фломастером.

    в) Дополнительные детали: репка, яичко — приклеить в последнюю очередь.

    Ребята, какие правила необходимо соблюдать в процессе выполнения аппликации? (Быть аккуратными и выполнять по порядку)

    — Молодцы. Приступаем к выполнению аппликации из осенних листьев.

    5. Самостоятельная работа. Дети работают под музыку. (П.И. Чайковский «Осенняя песня»)

    -Теперь, когда мы разобрали технику изготовления мышки, вы можете выполнить работу самостоятельно.

    Физкультминутка

    Мыши водят хоровод.

    встали в круг

    На лежанке дремлет кот

    1 ребёнок в центре

    «Тише, мыши, не шумите,

    хоровод идёт влево

    Кота Ваську не будите.

    Вот проснётся Вася- кот

    хоровод идет вправо

    Разобьёт весь хоровод!

    разбегаются по местам

    6. Закрепление материала.

    а) Беседа по теме:

    — Какую поделку вы сегодня выполнили? (Мышка0

    — Из какого материала? (Из сухих листьев)

    -Листья, каких деревьев были использованы для аппликации? (Берёза, осина )

    -Что важно помнить при работе с листьями? (Они хрупкие, их можно разрезать ножницами, наклеивать с помощью клея и салфетки.)

    -Прежде чем приступить к работе, о чём надо подумать? (Какие листья будут использованы, составить план работы.)

    б) Практическое применение.

    Изготовленную аппликацию можно поместить в рамочку под стекло. Это будет украшением комнаты.

    7.Итог урока.

    а) Оценка деятельности.

    Воспитатель. Работали дружно, выполняя правила безопасного поведения во время занятия. В результате много сделали, работы очень интересные. Мы их поместим на выставку.

    б) Уборка рабочего места.

    Воспитатель. Не забудьте тщательно помыть кисточки и протереть их салфеткой.

    Аппликация «Мышка — норушка» 2 мл.гр

    ?йымдастырыл?ан о?у ?рекетіні? технологиялык картасы

    Технологическая карта организованной учебной деятельности 2 младшая группа 30.03.15

    Білім беру саласы/Образовательная область:

    Б?лімдері /Разделы: Аппликация

    Та?ырыбы/Тема: Мышка-норушка

    Ма?саты/Цель: Учить детей изображать в аппликации предметы, состоящие из нескольких частей. Учить детей составлять композицию определенного содержания из готовых фигур. Уточнить знание цветов, развивать цветовое восприятие.

    Есептер/Задачи: Учить детей составлять фигуру из треугольных форм разной величины. Формировать обобщающее понятие «детеныши животных».

    Словарная работа:  серая, маленькая, шустрая, «мышка- норушка».

    ?остілдік компонент/билингвальный компонент: тыш?ан-мышь, серая-с?р, кішкентай-маленькая

    Іс-?рекет кезе?і/

    Этапы

    деятельности

    Педагогты?  іс-?рекеті

    Действия педагога

    Балаларды? іс-?рекеті

    Действия детей

    Мотивациялы? ?оз?аушылы?

    Мотивационно-

    побудительный

    Восп. Дорогие ребята, сегодня у нас в группе гости, давайте с ними поздороваемся!

    Восп. Ребята сейчас я вам загадаю загадку, а вы, попробуйте ее отгадать.

    Домик мой уютный – норка,

    Здесь сложила зерна горкой.

    В шубке серой меховой,

    Хвостик тонкий озорной.

    На головке крошки-ушки,

    Многие зовут Норушкой.

    Поскребусь, пока ты спишь,

    Ведь, недаром, же я – (Мышь).

    Восп. Правильно! Это мышка. (показывает карточку с изображением мышки). А сейчас мы поиграем в игру «Назови правильно». Я показываю вам карточку взрослого зверя, а вы называете детеныша. Например, Белка-бельчонок.

    дети здороваются, садятся на ковер

    Отгадывают загадку

    Дети называют медвежонок, лисенок, волчонок, зайчонок, поросенок, мышонок, котенок.)


    Просмотр содержимого документа

    «Аппликация «Мышка — норушка» 2 мл.гр »

    Ұйымдастырылған оқу әрекетінің технологиялык картасы

    Технологическая карта организованной учебной деятельности 2 младшая группа 30.03.15

    Білім беру саласы/Образовательная область:

    Бөлімдері /Разделы: Аппликация

    Тақырыбы/Тема: Мышка-норушка

    Мақсаты/Цель: Учить детей изображать в аппликации предметы, состоящие из нескольких частей. Учить детей составлять композицию определенного содержания из готовых фигур. Уточнить знание цветов, развивать цветовое восприятие.

    Есептер/Задачи: Учить детей составлять фигуру из треугольных форм разной величины. Формировать обобщающее понятие «детеныши животных».

    Словарная работа: серая, маленькая, шустрая, «мышка- норушка».

    Қостілдік компонент/билингвальный компонент: тышқан-мышь, серая-сұр, кішкентай-маленькая

    Іс-әрекет кезеңі/

    Этапы

    деятельности

    Педагогтың іс-әрекеті

    Действия педагога

    Балалардың іс-әрекеті

    Действия детей

    Мотивациялық қозғаушылық

    Мотивационно-

    побудительный

    Восп. Дорогие ребята, сегодня у нас в группе гости, давайте с ними поздороваемся!

    Восп. Ребята сейчас я вам загадаю загадку, а вы, попробуйте ее отгадать.

    Домик мой уютный – норка,

    Здесь сложила зерна горкой.

    В шубке серой меховой,

    Хвостик тонкий озорной.

    На головке крошки-ушки,

    Многие зовут Норушкой.

    Поскребусь, пока ты спишь,

    Ведь, недаром, же я – (Мышь) .

    Восп. Правильно! Это мышка. (показывает карточку с изображением мышки). А сейчас мы поиграем в игру «Назови правильно». Я показываю вам карточку взрослого зверя, а вы называете детеныша. Например, Белка-бельчонок.

    дети здороваются, садятся на ковер

    Отгадывают загадку

    Дети называют медвежонок, лисенок, волчонок, зайчонок, поросенок, мышонок, котенок.)

    Ұйымдастыру іздестіру

    Организационно – поисковый

    Воспитатель предлагает детям сесть за столы) .

    Восп. Посмотрите, ребята, что сейчас перед вами лежит на столе?

    Восп. Покажите мне пожалуйста самый большой треугольник, средний и маленький. А сколько всего треугольников лежит на столе? Давайте вместе их сосчитаем: один, два, три, четыре.

    Восп. Сейчас мы с вами изготовим мышат.

    Серая, белая и небольшая,

    Умная очень, смешная такая.

    Можно бояться, можно любить,

    Но равнодушным нельзя точно быть.

    Хвостик имеет, всюду грызет,

    Сыр или крупы всегда унесет.

    Возьмите большой треугольник, аккуратно намажьте его клеем. Клей наносим от центра к краям. Прижимаем треугольник к картону и приглаживаем салфеткой.

    Теперь нам нужно взять треугольник поменьше- это голова мышки. Прижимаем треугольник к картону и приглаживаем салфеткой.

    А теперь нам нужно приклеить ушки на макушку нашей мышки. Прижимаем треугольник к картону и приглаживаем салфеткой, теперь приклеиваем второе ушко.

    Физкультминутка

    Вышли мышки как-то раз (ходьба на месте или продвигаясь вперед в колонне)

    Поглядеть, который час (повороты влево, вправо, пальцы «трубочкой» перед глазами) .

    Раз, два, три, четыре (хлопки над головой в ладоши) .

    Мышки дернули за гири (руки вверх и приседание с опусканием рук «дернули за гири») .

    Вдруг раздался страшный звон (хлопки перед собой) .

    Убежали мышки вон (бег на месте или к своему месту) .

    белый картон, треугольники серого цвета разных размеров

    Приступают к изготовлению мышки

    Выполняют движения по тексту

    Рефлексивті- түзетушілік

    Рефлексивно – корригирующий

    Посмотрите еще раз на нашу Мышку. Какие сказки вы знаете, где она встречается?

    Я буду читать вам отрывок из сказки, а вы вспомните из какой :

    1) Бежит мимо мышка-норушка. Увидела, остановилась и спрашивает:

    — Кто там живет? Никто не отзывается. Вошла мышка и стала там жить.

    Восп. :- Из какой сказки отрывок?

    2) Мышка бежала, хвостиком махнула: яичко упало и разбилось.

    Старик плачет, старуха плачет; курочка кудахчет: «Не плачь, старик, не плачь, старуха.

    Я снесу вам яичко другое, не золотое – простое».

    Восп. :- Из какой сказки отрывок?

    3) Тянут-потянут, вытянуть не могут.

    Позвала кошка мышку.

    Мышка за кошку,

    Кошка за Жучку,

    Жучка за внучку,

    Внучка за бабку,

    Бабка за дедку, —

    Тянут-потянут …

    Восп. :- Из какой сказки отрывок?

    Восп. Молодцы, ребята! Сегодня вы постарались: правильно отгадывали загадки, показали хорошие знания сказок и у вас получились аккуратные и красивые мышата. Давайте вспомним, с чего мы начали работу?

    («Теремок»)

    («Курочка Ряба»)

    («Репка»)

    Ответы детей

    Күтілетін нәтиже/Ожидаемый результат:

    Нені біледі/Знать: знание цветов, развивать цветовое восприятие.

    Қандай түсініктердіигерді /Иметь: представление как составлять фигуру из треугольных форм разной величины

    Меңгерген дағдылары мен іскерліктері/Уметь: изображать в аппликации предметы, состоящие из нескольких частей

    Аппликация «Мышка» из бумаги своими руками

    Теплые чувства делают человека легким и невесомым, поднимает на седьмое небо… И, видимо не только человека! Поэтому милая аппликация, где влюбленные белые мышки парят на воздушных шариках – подходящий подарок к Дню всех влюбленных!

    Материалы и инструменты для мастер-класса «Аппликация «Мышки на шариках»»

    Нам потребуется:
    + кусок светло-зеленого картона для основы
    + белая бумага
    + цветная бумага – синего, зеленого, розового, желтого, красного и голубого цветов
    + бумага в клетку для шаблонов
    + простой карандаш
    + черная ручка
    + черный маркер или фломастер
    + красный фломастер
    + ножницы
    + клей ПВА

    Инструкции:

    1. Переносим на клетчатую бумагу контуры трех групп шаблонов:

    2. Вырезаем элементы первой группы шаблонов (мышка-мальчик):

    3. Используя соответствующие шаблоны, вырезаем из белой бумаги тело мышки, а из зеленой и синей — футболку и шорты соответственно:

    4.

    4. Из белой бумаги вырезаем голову и ушко, подклеиваем ушко к голове снизу:

    5. Приклеиваем к телу шортики, футболку и голову:

    6. Вырезав из белой бумаги глаз, приклеиваем деталь к голове, а потом всего мыша — к зеленой картонке-основе. Подчеркиваем черной ручкой контур глаза и уха, маркером обозначаем зрачок:

    7. Снова берем черную ручку и обводим контуры всех деталей мышкиной фигурки, а также дорисовываем носик и хвостик:

    8. Вырезаем шаблоны из второй группы (мышка-девочка):

    9. Используя необходимые шаблоны, вырезаем из белой бумаги тело мышки (сразу обозначим пальчики, ножки и стопы черной ручкой), а из розовой — ее платье. Склеиваем эти элементы:

    10. Из розовой бумаги вырезаем бантик и черной ручкой рисуем на нем складочки, из белой — голову (и на ней рисуем улыбку). Используя нужные шаблоны из группы 1, вырезаем ушко и глаз. Склеиваем эти элементы:

    11. Черным маркером дорисовываем зрачок, обводим черной ручкой контуры уха и глаза, рисуем реснички:

    12. Приклеиваем мышь к основе так, чтоб она держала своего друга за лапку, обводим контуры фигурки, черной ручкой дорисовываем носик, хвостик, пояс и складочки на платье, а красным фломастером раскрашиваем ботиночки и трогаем румянцем щечки:

    13. Вырезаем шаблоны третьей группы (дополнительные элементы):

    14. Из красной бумаги вырезаем два шарика-сердечка и наклеиваем их над мышками:

    15. Обводим контуры шариков черной ручкой и ей же дорисовываем им веревочки, черным маркером пишем слово «Love» на каждом:

    16. Из белой бумаги вырезаем облака (два крупных, по шаблону «Облако 1», и одно маленькое, по шаблону «Облако 2»). Наклеиваем их на нашу картинку:

    17. Из белой бумаги вырезаем двенадцать цветочков, из желтой и зеленой — такое же число серединок и листиков. Формируем из этих элементов много-много ромашек:

    18. Обводим контуры и дорисовываем стебли цветов черной ручкой:

    19. Вырезаем много разноцветных сердечек и произвольно распределяем их по картинке:

    Готово!

    Милого и радостного вам творчества!

    Пять приложений для настройки мыши

    Ряд утилит позволяют переназначить кнопки мыши или изменить поведение колеса прокрутки. Брайен Поузи перечисляет несколько найденных им.

    Компьютерные мыши использовались десятилетиями, и их легко принять как должное. Тем не менее, можно сделать вашу мышь немного более привлекательной, настроив ее поведение. Существует ряд утилит, которые позволяют вам делать такие вещи, как переназначение кнопок мыши или поведения колеса прокрутки.Есть даже утилиты, которые могут записывать макросы ваших движений мыши. В этой статье перечислены пять таких утилит.

    Это сообщение в блоге также доступно в виде галереи снимков экрана TechRepublic.

    Приложение недели Информационный бюллетень

    Не тратьте ни секунды на поиск ИТ- и бизнес-приложений — мы вам поможем.Наше популярное приложение недели может повысить вашу продуктивность, защитить электронную почту, отслеживать карьерные цели и многое другое.
    Доставка по четвергам

    Зарегистрироваться Сегодня

    Пять приложений

    1. Центр мыши и клавиатуры

    Microsoft Mouse and Keyboard Center — бесплатная утилита для настройки поведения мышей Microsoft.Центр мыши и клавиатуры Microsoft позволяет назначать функции отдельным кнопкам мыши. Хотя эта базовая функциональность полезна, лучшая функция утилиты состоит в том, что она позволяет назначать кнопки для конкретных приложений. Таким образом, правой кнопке мыши можно назначить одну функцию в проводнике и другую функцию в Microsoft Office.

    2. WizMouse

    WizMouse — это бесплатная утилита, которую можно использовать для настройки поведения мыши. Основная функция утилиты — включить колесо мыши для приложений, которые изначально не поддерживают его использование.Также есть удобная функция «реверса» для использования в тех случаях, когда мышь прокручивается назад. WizMouse можно включить или отключить из панели задач.

    3. KatMouse

    KatMouse — это бесплатная утилита, которая позволяет использовать колесо прокрутки мыши в окне под курсором мыши. Это можно сделать независимо от выбранного в данный момент окна. Другими словами, KatMouse позволяет прокручивать неактивное окно.

    Утилиту также можно использовать для переключения задач.Поскольку кнопка колеса обычно используется непоследовательно, KatMouse позволяет использовать ее для переключения задач, перемещая текущее окно в конец стопки открытых окон. KatMouse также может назначать приложению пользовательские настройки прокрутки.

    4. MouseWrangler

    MouseWrangler — это бесплатный инструмент, предназначенный для автоматизации утомительных задач. Удерживание правой кнопки мыши инициирует запись макроса (который MouseWrangler называет жестом).Макросы можно использовать для автоматизации любой задачи, которая обычно выполняется с помощью мыши. Окольными путями можно даже имитировать ввод с клавиатуры. Для более сложных операций MouseWrangler можно использовать для запуска внешних макросов (например, в Microsoft Office).

    Одна из самых приятных особенностей MouseWrangler — это то, что она портативна. Хотя утилита поставляется с установщиком, вам не обязательно использовать ее, если вы этого не хотите.

    5. Мышь-призрак

    Ghost Mouse — бесплатная утилита, предназначенная для записи макросов.Этот инструмент предлагает очень простой пользовательский интерфейс, который легко изучить. Процесс записи макроса может фиксировать движения мыши, щелчки мыши, задержки и ввод с клавиатуры. После захвата макрос можно сразу сохранить или воспроизвести.

    Читайте также:

    Remote Mouse в App Store

    Remote Mouse ™ превращает ваш iPhone или iPad в удобный пульт дистанционного управления для вашего компьютера. Он имитирует работу беспроводной мыши, клавиатуры и сенсорной панели, а также предоставляет различные специализированные панели управления, такие как Media Remote, Application Switcher и Web Browsing Remote, что помогает вам быстрее выполнять определенные операции.Небольшие функции, предназначенные для использования одной рукой или интуитивно понятного управления, также порадуют вас.

    Представленный на CNET, Mashable и Product Hunt, Remote Mouse, который считается одним из самых элегантных и простых в использовании компьютерных удаленных приложений, используется более чем 20 миллионами пользователей по всему миру.

    Смотрите онлайн-фильм? Делаете презентацию? Или выключить компьютер одним щелчком мыши? Нет ничего более удобного, чем пульт для мобильного телефона, который всегда у вас под рукой.

    Мышь
    • Полностью смоделированная беспроводная мышь
    • Гироскопическая мышь, которая позволяет перемещать курсор мыши с помощью гироскопического датчика
    • Режим для левой руки

    Клавиатура
    • Интегрирована с системными и сторонними клавиатурами, поддерживает набор текста на различных языках
    • Удаленный набор текста голосом, если программная клавиатура поддерживает распознавание голоса
    • Поддерживает отправку различных сочетаний клавиш (версия Pro)
    • Отображает различные клавиатуры для Mac или ПК (версия Pro)

    Сенсорная панель
    Имитирует Apple Magic Trackpad и поддерживает мультитач-жесты

    Специальные панели управления
    • Media Remote (покупка в приложении): поддерживает iTunes, VLC, Windows Media Player, Keynote, PowerPoint и Windows Photo Viewer и будет поддерживать больше
    • Web Remote (покупка в приложении): поддерживает Chrome, Firefox , и Opera
    • Application Switcher: быстрый запуск и переключение между программами
    • Power Options: поддерживает удаленное выключение, спящий режим, перезапуск и выход из системы

    Другие функции
    • Использование физических кнопок регулировки громкости на мобильном устройстве для дистанционного управления (покупка в приложении)
    • Установка пароля для подключения
    • Настраиваемые обои

    Метод подключения
    • Автоматическое подключение
    • Подключение через IP-адрес или QR-код
    • Подключение через историю

    Операционная среда
    • Совместимость с Windows 10, 8, 7, Vista, Mac OSX 10.6+ и Linux
    • Работает в сети Wi-Fi или 3G / 4G

    Для начала работы
    1. Посетите сайт www.remotemouse.net на своем компьютере и загрузите компьютерный сервер Remote Mouse
    2. Установите и запустите компьютерный сервер
    3. Подключите мобильное устройство к той же точке доступа Wi-Fi или точке доступа, что и ваш компьютер.

    Помогите нам перевести
    Если вы заинтересованы в переводе Remote Mouse на свой родной язык, присоединяйтесь к нашему совместному проекту перевода на remotemouse.oneskyapp.com

    X-Mouse Button Control — это бесплатный инструмент для Windows, который позволяет вам перенастроить и расширить возможности вашей мыши.


    Загрузить:


    Обзор:

    X-Mouse Button Control (XMBC) позволяет создавать профили для конкретных приложений и окон. Это, в свою очередь, позволяет вам перенастроить поведение мыши для отдельных приложений или окон.
    Для каждого профиля вы также можете настроить до 10 «слоев» с различными конфигурациями кнопок, между которыми вы можете переключаться с помощью горячих клавиш или кнопок мыши.

    По умолчанию профили автоматически активируются при перемещении мыши по определенному окну или приложению.
    Это имеет много применений, например:

    • Изменение поведения мыши над определенными окнами, например изменение громкости колесика мыши при наведении курсора на панель задач или видео на YouTube.
    • В играх, которые изначально не поддерживают расширенные, 4-ю и 5-ю кнопки мыши, вы можете назначить клавиши каждой кнопке.

    XMBC позволяет изменять поведение кнопок мыши и колеса прокрутки. Обширный список функций, доступных для сопоставления с кнопками мыши, включает такие параметры, как:

    • Отправляйте любые клавиши с помощью редактора имитации нажатия клавиш
    • Кнопки привязки (сдвиг / комбинирование) выполняют разные действия
    • Действия кнопки по времени, которые меняются в зависимости от того, как долго вы удерживаете кнопку в течение
    • Запустить любое приложение Windows
    • Элемент управления буфером обмена (копирование / вырезание / вставка)
    • Управление мультимедиа (воспроизведение / пауза / остановка / громкость / отключение звука и т. Д.)
    • Захват изображения экрана (или активного окна) в буфер обмена
    • Нажми и перетащи [залипающие кнопки / клавиши]
    • Нажми и перетащи [залипающие кнопки / клавиши]
    • Различная поддержка определенных операционных систем Windows, таких как Flip3D в Vista, ModernUI / Metro в Windows 8 и Virtual Desktops в Windows 10!
    • И многое, многое другое!

    Для получения дополнительной информации об использовании и настройке X-Mouse Button Control,
    пожалуйста, ознакомьтесь с новым руководством пользователя (зеркало).

    X-Mouse Button Control в настоящее время поддерживает Windows XP, 2003, 2003 R2, Vista, 2008, 2008 R2, 7, 8, 2012, 8.1, 2012 R2, 2016 и 2019 (версия с графическим интерфейсом) и 10.
    Первоначально он был разработан для работы в x64-версиях Windows, но полностью поддерживается и в 32-битных версиях! Установка определяет, какая версия требуется (x64 или x86) автоматически во время установки.


    Пожертвования:

    Обратите внимание, что пожертвования — это всего лишь пожертвования.Они не предназначены для использования, чтобы убедить меня добавить новые функции или предоставить дополнительную поддержку — я делаю все, что могу, бесплатно и не жду пожертвований (хотя они приветствуются).
    Вы можете сделать пожертвование через PayPal, используя кнопку пожертвования.

    Вы также можете сделать пожертвование с помощью биткойнов, используя кнопку ниже:


    Информация об установке / обновлении:

    Установщик автоматически закроет существующий экземпляр XMBC, поэтому вам не нужно закрывать или удалять старый
    версию перед установкой последней.

    X-Mouse Button Control настроен на автоматический запуск при входе в Windows.
    Это можно изменить с помощью MSConfig или вкладки запуска в диспетчере задач в Windows 8 или более поздней версии.


    Требования:

    • Мышь и драйвер, поддерживающий до 5 кнопок.

      ПРИМЕЧАНИЕ. Если у вашей мыши 5 кнопок, но 4-я и 5-я кнопки ничего не делают
      по умолчанию — тогда XMBC может быть не для вас.Это программное обеспечение полагается на
      драйвер для отправки сообщений 4-й и 5-й кнопок мыши по умолчанию, которые обычно по умолчанию BACK / NEXT в
      браузеры и другие программы. Сказав, что вы все еще можете переназначить стандартные 2 кнопки и колесо прокрутки.
    • Совместимая версия Microsoft Windows.

      X-Mouse Button Control поддерживает все 32-битные (x86) и 64-битные (x64) версии
      Windows от Windows XP до 10, включая выпуски Windows Server!

    FAQ:

    • Я переместил все часто задаваемые вопросы на форум, чтобы все было единообразно.Пожалуйста, взгляните на
      эта ветка
    • Если на ваш вопрос нет ответа в
      ЧАСТО ЗАДАВАЕМЫЕ ВОПРОСЫ,
      пожалуйста, просмотрите форумы и посмотрите, есть ли ваш вопрос
      спросили там.
      Если нет, зарегистрируйтесь и спросите!
    • Имейте в виду, что у меня было много запросов на XMouse, но, к сожалению, у меня также есть далеко
      в наши дни меньше времени на работу над этим.
      Я в первую очередь сосредотачиваюсь на ошибках, которые останавливают текущую функциональность
      работает, а не добавляет новую функциональность.

    Скриншоты (Нажмите, чтобы увеличить)


    Контакт:

    Свяжитесь со мной, если у вас есть вопросы / запросы.
    Желательно зарегистрироваться и обсудить любые проблемы в
    Форумы поддержки Highrez
    В качестве альтернативы вы можете попробовать написать мне по адресу
    но ПОЖАЛУЙСТА, имейте в виду, что мой антиспам настроен довольно высоко, поэтому, если вы не получите ответа, напишите мне на моем форуме !!


    Заявление об отказе от ответственности:

    Обратите внимание, что, хотя автор активно запускает и тестирует это программное обеспечение на нескольких машинах и в разных версиях Windows,
    не предоставляется никаких гарантий или гарантий в отношении производительности программного обеспечения или отсутствия в нем ошибок.Ни автор, ни кто-либо другой, участвовавший в производстве, тестировании или поставке этого программного обеспечения, не несут ответственности за
    любые повреждения любого типа.

    Все загрузки проверяются на наличие известных вирусов на момент публикации.

    Дизайн, анализ и применение клинических испытаний на мышах при разработке онкологических препаратов | BMC Cancer

    Определение количества мышей для категориальных ответов

    Мы собрали данные об объеме опухоли при лечении препаратом для 26127 мышей из 2883 уникальных лечебных PDX, 11139 мышей из 1219 уникальных лечебных CDX и 5945 мышей из 637 уникальных лечебных сингенных моделей.Уникальная модель лечения — это модель на мышах, которую лечили лекарством в ходе исследования. В каждом уникальном лечении содержится не менее 8 мышей. Категориальный ответ на лекарственный препарат определяли с помощью 4 методов (см. Материалы и методы), и мы проиллюстрировали результаты с помощью критерия mRECIST, который классифицирует лекарственный ответ на 4 категории: полный ответ (CR), частичный ответ (PR), стабильное заболевание (SD). , и прогрессирующее заболевание (PD). Для каждой уникальной модели лечения ее ответ — это ответ большинства мышей. Мы наблюдали, что ответы отдельных мышей чаще всего соответствовали ответам большинства для PD: 90% для PDX, 95% для CDX и сингенных моделей (рис.1а-в). Остальные 3 категории ответов демонстрируют более низкую согласованность, особенно для сингенных моделей. Из 10 уникальных сингенных моделей лечения, классифицированных как CR, только половина мышей также имела полный ответ, в то время как 17% мышей были PD и устойчивы к лечению. Такая картина поляризованного отклика наблюдается и в других трех методах (дополнительный файл 1: Рисунок S1-S3). Для всех 4 категорий ответов существует большая разница. Например, только около 70% индивидуальных ответов соответствовали ответам большинства для трети из 107 моделей PDX уникального лечения, отнесенных к категории CR, хотя средний показатель составляет 83%.

    Рис. 1

    Число мышей и точность измерения категориальных ответов, определенных критериями mRECIST. ( ac ): индивидуальный ответ мыши и ответ большинства в PDX ( a ), CDX ( b ) и сингенных моделях ( c ), ось x — количество ответов большинства из 4 категорий ответов (CR: полный ответ, PR: частичный ответ, SD: стабильное заболевание, PD: прогрессирующее заболевание.), ось y — процент индивидуального ответа мыши относительно большинства (среднее ± s.д.). 26127 мышей находятся в 2883 моделях уникального лечения PDX, 11 139 мышей в 1219 уникальных моделях лечения CDX и 5945 мышей в 637 уникальных сингенных моделях лечения. В каждой уникальной модели лечения было не менее 8 мышей. ( d-g ): точность измерения увеличивается с количеством мышей для PDX ( d ), CDX ( e ) и сингенных моделей ( f ). Для каждой уникальной модели лечения был получен ответ большинства n ( n = 1, 3, 5, 7 по оси x) случайно выбранных мышей, чтобы увидеть, согласуется ли он с фактическим ответом большинства.Процедура была повторена 1000 раз, чтобы получить точность — процент раз (среднее ± стандартное отклонение), с которым они согласились, — для 4 категорий ответов, невзвешенное среднее значение которых показано в ( g ). (h-j): диаграмма Венна, показывающая перекрытие уникальных моделей лечения PDX, классифицированных как объективный ответ 4 категориальными методами в PDX ( h ), CDX ( i ) и сингенных моделях ( j ). Объективный ответ — ИЛИ в методе 3-х кошек, CR + PR в методах mRECIST и RECIST, MCR + CR + PR в методе 5-кошек

    Точность измерения увеличивается с увеличением количества мышей.Мы случайным образом отобрали n ( n = 1, 3, 5, 7) мышей из всех мышей, участвовавших в лечении, и получили ответ большинства, который затем сравнивали с фактическим ответом большинства. Процедуру повторяли 1000 раз для получения статистических результатов (рис. 1d-f). Точность возрастает с увеличением количества мышей для всех 4 категорий, и их невзвешенное среднее значение выше у CDX, что немного выше, чем у PDX, в то время как сингенные модели имеют гораздо более низкую точность (рис. 1g). Следовательно, для сингенных моделей требуется больше мышей, чтобы достичь такой же точности, как PDX / CDX.Например, точность сопоставима между сингенными исследованиями с 5 мышами на модель и исследованиями PDX / CDX с 1 мышью на модель. Подобные шаблоны также наблюдаются в других 3 методах (Дополнительный файл 1: Рисунок S1-S3).

    Все 4 метода классифицируют ответы на основе относительного объема опухоли (RTV) на более поздний день до дня начала лечения, но различаются конкретными пороговыми значениями. Таким образом, уникальную модель лечения можно классифицировать по-разному. Мы обнаружили, что существует хорошее совпадение уникальных моделей лечения, классифицируемых как объективный ответ между 4 методами (рис.1h-j), и их показатели объективного ответа (ЧОО) аналогичны. (Дополнительный файл 1: Таблица S1). Тем не менее, существует множество моделей, уникальных только для некоторых методов, например, OR, предупреждающих о предвзятости и применимости метода. Например, mRECIST рассматривает усреднение уменьшения опухоли в течение определенного периода времени, поэтому уникальная модель лечения может быть классифицирована как PD, даже если опухоль полностью исчезает в конце исследования (дополнительный файл 1: рисунок S4).

    Определение количества мышей для непрерывных ответов

    Эффективность лекарств можно измерить по непрерывным ответам, некоторые из них являются прямой адаптацией клинических конечных точек (например,g., PFS и OS), другие являются уникальными для исследований на мышах, в которых используются данные как из групп лечения носителем, так и из группы лекарственного средства (например, соотношение RTV между группами лекарственного средства и группы носителя). Мы рассчитали ошибки оценки PFS и отношения RTV, рассчитанные для n ( n = от 1 до 9) мышей, случайно выбранных из ≥10 мышей в исследовании, и получили количественную связь между ошибками оценки и количеством мышей (рис. 2 ). ) . Для каждого n мы получили эмпирическую кумулятивную функцию плотности (ECDF) относительно процентной ошибки оценки PFS для PDX, CDX и сингенных моделей (рис.2a-c), а также в отношении абсолютной ошибки оценки отношения RTV для трех типов моделей (рис. 2e-g). Большие ошибки оценки присущи небольшим размерам выборки, особенно для сингенных моделей. Например, процентная ошибка PFS превышает 20% для 63% сингенных мышей и примерно для половины мышей PDX / CDX (рис. 2d). Ошибки оценки резко уменьшаются за счет добавления большего количества мышей, когда n мало. Что касается отношения RTV, 3 мыши в группе как лекарственного средства, так и группы носителя уже подняли мышей с абсолютной ошибкой <0.2 от 60% до более 80% для PDX / CDX (рис. 2h). Аналогичные результаты справедливы и для других непрерывных конечных точек (дополнительный файл 1: рисунок S5).

    Рис. 2

    Определение количества мышей для непрерывных ответов. ( ac ): Выживаемость без прогрессирования, или ВБП, рассчитанная для n мышей (n = от 1 до 9), произвольно выбранных из уникальной модели лечения по меньшей мере с 10 мышами, показывает относительное отклонение от ВБП, рассчитанное для всех мышей в PDX ( a ), CDX ( b ) и сингенных моделей ( c ), ось x — процентная ошибка PFS, а ось y — эмпирическая функция кумулятивной плотности (ECDF), оцененная на основе случайных выборок для каждого n. .Процент ошибки PFS уменьшается с увеличением количества мышей, и ошибка больше для сингенных моделей, чем для PDX / CDX. ( d ): Процент уникальных моделей лечения с процентной ошибкой менее 20% в 3 типах моделей мышей. (, например, ): отношение RTV между группами лекарственного средства и носителя, рассчитанное для n мышей (n = от 1 до 9), произвольно выбранных из исследования с по меньшей мере 10 мышами в группах как лекарственного средства, так и носителя, показывает отклонение от отношения RTV, рассчитанного из у всех мышей в обеих группах в PDX ( e ), CDX ( f ) и сингенных моделях ( g ), ось x — абсолютная ошибка, а ось y — эмпирическая функция кумулятивной плотности (ECDF), оцененная из случайные выборки для каждого n.Абсолютная ошибка отношения RTV уменьшается с увеличением количества мышей, и ошибка больше для сингенных моделей, чем для PDX / CDX. ( h ): Процент исследований с абсолютной ошибкой менее 0,2 в трех типах моделей мышей

    Моделирование МСТ в виде кластерных продольных исследований

    Эффективность лекарственного средства удобно измерять с помощью категориальной или непрерывной конечной точки, но эти подходы также страдают от потери информации и других недостатков. Например, выбор дня для расчета коэффициента RTV и TGI является несколько произвольным; это добавляет логистическую нагрузку, чтобы сопоставить мышей с сопоставимым объемом опухоли в день начала лечения [24]; трудно справиться с выпадением мыши.Эти недостатки могут быть преодолены путем моделирования MCT в виде кластерных продольных исследований, в которых кластер состоит из всех мышей модели мыши, поэтому они имеют общий геномный профиль и имеют более похожий ответ на лекарственный препарат. Каждая мышь находится в продольном исследовании. Можно показать, что рост опухоли у большинства мышей следует экспоненциальной кинетике (дополнительный файл 1: рисунок S6). Таким образом, мы можем смоделировать кластерные продольные исследования с помощью трехуровневой линейной смешанной модели (LMM) на логарифмически преобразованных объемах опухолей (logTV) и днях (рис.3а). Существуют ковариаты, связанные с моделями мышей, такие как тип рака и геномные особенности, которые можно использовать для изучения разницы в эффективности в отношении рака и для обнаружения прогностических биомаркеров.

    Рис. 3

    Линейные смешанные модели (LMM) могут использоваться для моделирования сгруппированных продольных данных из MCT. ( a ) структура сгруппированных продольных данных для PDX в MCT. Ковариаты уровня PDX и уровня мыши могут быть включены в LMM. ( b ) Средние кривые роста опухоли для 3 видов рака при лечении носителем и обработкой цисплатином.( c ) Статистические кривые мощности МСТ цисплатина. Мощность рассчитывается на уровне значимости α = 0,05, когда лечение цисплатином снижает скорость роста опухоли от 10 до 90%, то есть β 1 / β 2 = от — 0,1 до — 0,9 в уравнении. 4 в «Материалы и методы». 10 цветных кривых на каждом графике обозначают количество мышей для каждого PDX в каждой руке.

    Мы используем один пример, чтобы продемонстрировать моделирование MCT с помощью LMM для оценки и сравнения эффективности. В этом MCT цисплатин — химиотерапевтический препарат — вводили 42 PDX (4 мг / кг, еженедельная доза в течение 3 недель), включая 13 видов рака пищевода (ES), 21 рак желудка (GA) и 8 видов рака легких (LU), каждый PDX с 5–9 мышами (дополнительный файл 1: рисунок S7).Мы подбираем данные по эффективности с помощью LMM (уравнение 3 в материалах и методах), который явно моделирует гетерогенность скорости роста опухоли и гетерогенность ответа на лекарства как на уровне PDX, так и на уровне мыши. Подгонка модели удовлетворительна (Таблица 1 , Дополнительный файл 1: Рисунок S8). Мы пришли к выводу, что (1) при лечении носителем опухоль в GA растет немного быстрее, чем в ES, в то время как рост опухоли намного быстрее в LU; (2) цисплатин имеет сравнимую эффективность в отношении трех видов рака ( p — значения для β 5 и β 6 > 0.05). Результаты могут быть легко визуализированы с помощью средних кривых роста для 3 видов рака ниже (рис. 3b).

    Таблица 1 Параметры, оцененные для LMM (уравнение 3) набора данных цисплатина

    Статистическая мощность и определение размера выборки в MCT

    Как и в клинических испытаниях, рациональный дизайн MCT требует расчета статистической мощности и определения размера выборки — количество модели мышей и количество мышей на модель мыши. Мы демонстрируем это в рамках LMM со следующими допущениями (1) сбалансированный n: n-дизайн, в котором n (≥1) мышей в группах как препарата, так и носителя, и (2) 21-дневное испытание с опухолью. объем, измеренный в начале лечения, а затем дважды в неделю, чтобы получить 8 точек данных для каждой мыши.Эффективность лекарственного средства измеряется тем, насколько лекарственное лечение замедляет рост опухоли (β 2 / β 1 в уравнении 4). Кривые мощности были получены с помощью компьютерного моделирования на основе параметров, полученных в результате подгонки набора данных цисплатина по формуле. 4 (рис. 3в).

    Мы заметили, что если количество PDX одинаково, большее количество мышей на PDX дает лучшую статистическую мощность. Например, для достижения 80% мощности нам нужно около 28 PDX для дизайна 1: 1 (по 1 мыши в каждой группе носителя и лечения лекарством) и 11 PDX для дизайна 3: 3 (по 3 мыши в носителе и группы медикаментозного лечения).Что еще более важно, статистическая мощность сопоставима для дизайнов с одинаковым общим количеством мышей. Например, когда эффективность лекарства составляет 20%, то есть лекарство снижает скорость роста опухоли на 20%, все следующие конструкции достигают 90% мощности при уровне значимости 0,05: 36 PDX с дизайном 1: 1, 19 PDX с 2: 2, 13 PDX с дизайном 3: 3, 10 PDX с дизайном 4: 4 и т. Д. Однако важно отметить, что такие конструкции со сходной статистической мощностью и общим количеством мышей имеют разные биологические последствия.Дизайн с большим количеством PDX, но меньшим количеством мышей или даже одной мыши на PDX может дать лучшее представление и измерение межопухолевой гетерогенности, в то время как дизайн с меньшим количеством PDX, но большим количеством мышей на PDX жертвует такой межопухолевой гетерогенностью, чтобы дают более точное измерение эффективности препарата для каждого PDX. Выбор дизайна зависит от целей исследования. Например, мы, вероятно, предпочтем дизайн с большим количеством PDX с меньшим количеством мышей для обнаружения биомаркеров, потому что это даст нам более широкое представление о межопухолевой гетерогенности и больше наборов геномных данных для работы.В крайнем случае мы можем использовать схему 1: 1, если в распоряжении имеется много PDX — подход 1x1x1 [6], в котором Gao et al. показали, что дизайн 1: 1 эффективен при оценке биомаркеров и оценке эффективности. Но для проверки биомаркера мы можем использовать дизайн с ограниченным количеством выбранных моделей PDX, которые, по прогнозам, будут реагировать или устойчивы, и каждый PDX должен иметь относительно большое количество мышей, чтобы измерение эффективности было достаточно точным для измерения эффективности. биомаркера.Дизайн также ограничен доступным ресурсом, например, когда есть только ограниченное количество подходящих PDX, например, PDX, несущие конкретную мутацию, или PDX определенного подтипа, мы можем увеличить количество мышей на PDX, чтобы повысить статистическую мощность. .

    Мы также заметили, что требуется меньшее количество PDX, чтобы более сильнодействующий препарат достиг той же статистической мощности. Например, для достижения 80% статистической мощности при уровне значимости 0,05 по схеме 3: 3 нам необходимо около 40, 11 и 5 PDX для препаратов с эффективностью 10, 20 и 30% соответственно.Когда лекарство достаточно сильнодействующее, все n: n дизайны достигают высокой мощности при очень небольшом количестве PDX. В таких случаях мы используем большое количество PDX не для статистической оценки, а для лучшего представления неоднородности опухоли.

    Анализ выживаемости в MCT

    В клинических испытаниях предполагается, что выживаемость пациентов не зависит друг от друга. В случае MCT это предположение больше не выполняется, потому что мыши теперь сгруппированы в PDX, а мыши с одним и тем же PDX, как правило, имеют более похожее время выживания, в то время как их время выживания между обработками сильно коррелировано (рис.4а). Кроме того, PDX могут сильно различаться по скорости роста (или опасности) и реакции на лекарства (дополнительный файл 1: рисунок S9). Поэтому мы используем аддитивную модель хрупкости для моделирования неоднородности опасности и эффективности лекарств в кластерной популяционной структуре МСТ (см. Уравнение 5 в разделе «Материалы и методы»). Модель аддитивной хрупкости является расширением модели пропорциональных рисков Кокса, широко используемой в клинических испытаниях. Он имеет два неустойчивых термина: первый u i количественно определяет неоднородность скорости роста PDX, а второй v i измеряет неоднородность лекарственного ответа.

    Рис. 4

    Анализ выживаемости в МСТ цисплатина. ( a ) Среднее время выживаемости без прогрессирования (PFS) PDX при лечении цисплатином и носителем сильно коррелировано. Пунктирная линия — это линии линейной регрессии, а сплошная линия — это линия с единичным уклоном. ( b ) Первый член слабости u i в уравнении. 5 положительно коррелирует со скоростью роста опухоли k c . ( c ) Кривые выживаемости при обработке цисплатином и носителем.Модель аддитивной хрупкости дает более точное отношение рисков (HR), чем модель пропорциональных рисков Кокса, оценка которой составляет 0,36 (95% ДИ: 0,28–0,46). (d) Статистические кривые мощности при уровне значимости α = 0,05, когда отношение рисков составляет 0,9–0,1 для анализа выживаемости. 10 цветных кривых на каждом графике обозначают количество мышей на PDX на руку.

    Мы используем MCT цисплатина, чтобы проиллюстрировать использование аддитивной модели хрупкости. Общая выживаемость (ОС) определяется как время утроения объема опухоли.Мы подбираем набор данных MCT цисплатина по формуле. 5, и наблюдал, что оба показателя хрупкости значимо больше 0 (тест Вальда p — значение <0,05), что доказывает, что PDX растут с разной скоростью и имеют разные ответы на цисплатин. Фактически, первый термин слабости u i отрицательно коррелирует со скоростью роста опухоли в группе носителя, как и ожидалось (R 2 = 0,85, фиг. 4b).

    Эффективность лекарственного средства можно оценить более точно, исключив влияние неоднородности роста опухоли и рассмотрев неоднородность лекарственного ответа, которая измеряется вторым показателем слабости v i .Действительно, отношение рисков (HR) оценивается в 0,21 (95% ДИ: 0,15–0,31), что намного меньше, чем полученное с помощью модели пропорциональных рисков Кокса, которая дает HR = 0,36 (95% ДИ, 0,28–0,46) ( Рис. 4в). Эти результаты показывают, что без учета неоднородности PDX эффект лекарственного средства может быть сильно недооценен.

    Мы выполнили статистический анализ мощности для анализа выживаемости, предполагая n: n-схемы и используя параметры, оцененные на основе MCT цисплатина с функциями риска Вейбулла (рис.4г). Как и в LMM, статистическая мощность аналогична для конструкций с одинаковым общим количеством мышей.

    Обнаружение биомаркеров в MCT

    Геномная корреляция с эффективностью цетуксимаба при солидных опухолях была хорошо документирована [13], и мы ранее сообщали о MCT для когорты из 20 PDX рака желудка, каждая из которых содержала 3–10 мышей в носителе и цетуксимабе. лечебные руки. Мы обнаружили, что экспрессия EGFR является прогностическим биомаркером цетуксимаба при раке желудка [19]. Когорта теперь расширена до 27 PDX (дополнительный файл 1: рисунок S10).Мы наблюдали сильную корреляцию между экспрессией EGFR и эффективностью лекарства, измеряемой по ингибированию роста опухоли или TGI (рис. 5а). Когда все 18586 генов были ранжированы от высокого к низкому по абсолютному значению коэффициента корреляции между их экспрессией и TGI, EGFR занял 157 место среди всех этих генов, демонстрируя, что такие простые методы обнаружения биомаркеров могут давать много ложноположительных результатов с кажущейся лучшей предсказуемостью. чем истинный биомаркер.

    Рис. 5

    Обнаружение биомаркеров и исследование MoA в MCT.(a-b): MCT 27 PDX рака желудка, обработанных цетуксимабом. EGFR занимает 157-е место среди всех генов на основе ранговой корреляции Спирмена между экспрессией EGFR и TGI ( a ), но является ведущим геном для прогнозирования эффективности цетуксимаба на основе линейной смешанной модели (LMM) ( b ). ( c-e ): MCT из 16 PDX, обработанных внутрибрюшинной инъекцией иринотекана (100 мг / кг, один раз в неделю в течение 2-3 недель). ( c ): R-HAS-160170, путь клеточного цикла в базе данных Reactome2016, неизменно оценивается как наиболее обогащенный путь с от 100 до 2000 главных генов, выбранных LMM, превосходит лучшие гены, выбранные методами, основанными на категориальных конечных точках (е.g., RECIST, таблица S2) и непрерывные конечные точки (например, TGI). ( d ): инициация репликации ДНК (GO: 0006270) — это наиболее обогащенный термин GO, основанный на лучших генах, выбранных LMM. ( e ): высокообогащенная сеть белок-белковых взаимодействий ( p — значение <10 — 16 ) состояла из 23 генов в 100 лучших генах, выбранных LMM. Узлы красного цвета — это узлы, участвующие в клеточном цикле (GO: 0007049). Пунктирные горизонтальные линии в ( c-d ) обозначают значение p = 0.01. ( f ): Средние кривые роста опухоли для PDX с наивысшей и самой низкой экспрессией мРНК ERCC1 в MCT из 21 PDX желудка, обработанного цисплатином

    . Мы использовали LMM, которая явно моделирует влияние гена на рост опухоли, чтобы соответствовать эффективности. данные (уравнение 6 в материалах и методах). EGFR выделяется как наиболее значимый ген, и его значение p , составляющее 1,5 × 10 — 23 , по крайней мере на пять порядков меньше, чем у всех других генов (рис. 5b). EGFR как прогностический биомаркер цетуксимаба при раке желудка подтверждается клиническими испытаниями фазы 2 [25] и клиническими испытаниями фазы 3 с повторной интерпретацией данных (дополнительный файл 1: рисунок S11) [26].Это исследование показывает, что простой анализ может привести к множеству ложноположительных результатов, что затруднит обнаружение биомаркеров, особенно когда мишень лекарственного средства неизвестна или есть нецелевые эффекты, в то время как более сложный метод LMM может быть лучше в обнаружении биомаркеров.

    Изучение механизма действия в МСТ

    МСТ используются для оценки эффективности лекарственного средства и открытия биомаркеров, последнему может способствовать лучшее понимание механизма действия лекарственного средства (MoA), что помогает идентифицировать соответствующие гены, пути и наборы генов , и удалить ложноположительные гены, которые могут иметь более высокую статистическую значимость, т.е.е. ниже p -значения, в некотором анализе. Биомаркеры, сконструированные из выбранных таким образом генов, имеют явное биологическое значение и часто являются предпочтительными.

    С легкодоступными геномными данными и данными об эффективности из MCT, исследования MoA могут быть легко выполнены. Как и в случае обнаружения биомаркеров, простые категориальные и непрерывные конечные точки, как общий итог эффективности, имеют различные недостатки. Например, четыре категориальных метода измеряют эффективность только в группе лечения препаратом, игнорируя относительную эффективность препарата и носителя.Соотношение RTV и TGI зависят от дня расчета и скорости роста опухоли (дополнительный файл 1: рисунок S12). Опять же, мы можем использовать LMM для лучшего изучения MoA, как показано в примере ниже.

    Иринотекан представляет собой ингибитор ДНК-топоизомеразы I, который прерывает клеточный цикл в S-фазе, необратимо блокируя репликационную вилку, вызывая, таким образом, гибель клеток [27]. Мы провели MCT для 16 PDX (Дополнительный файл 1: Рисунок S13), каждый PDX с 3–10 мышами. Мы смоделировали влияние экспрессии генов на эффективность лекарств с помощью LMM (ур.6). Лучшие гены были высоко обогащены по пути клеточного цикла R-HSA-160170 в базе данных Reactome 2016 (рис. 5c) и по инициации репликации ДНК (аннотация Gene Ontology GO: 0006270) (рис. 5d), что прекрасно показывает МоА для иринотекана. Сильно связанная сеть белок-белкового взаимодействия для клеточного цикла также определяется из 100 генов, занявших первое место (рис. 5e). Напротив, методы, основанные на конечных точках, гораздо менее информативны (рис. 5c-d, дополнительный файл 1: таблица S2-S4).

    МСТ могут объяснить парадоксальные результаты клинических испытаний

    Существуют противоречивые отчеты о клинических испытаниях относительно роли экспрессии ERCC1 в прогнозировании лечения цисплатином при раке желудка: некоторые утверждали, что пациенты получают больше пользы от низкой экспрессии ERCC1 [28,29,30,31,32 ], некоторые утверждали обратное [33,34,35], тогда как другие не нашли никакой связи [36].

    В предыдущем разделе мы описали МСТ цисплатина, который включает 21 PDX рака желудка. Мы аппроксимируем данные объема опухоли формулой. 6. Параметр β 2 количественно определяет, как экспрессия ERCC1 влияет на рост опухоли при отсутствии лекарственного вмешательства, как видно из кривых роста носителя (фиг. 5f). Параметр β 4 оценивает, как экспрессия ERCC1 влияет на эффективность цисплатина в отношении роста опухоли, как видно из сравнения кривых роста цисплатина с соответствующими кривыми роста носителя.Эти два параметра имеют сравнимую величину, но с противоположными знаками ( β 2 = — 0,0155 и β 4 = 0,0136). Следовательно, когда экспрессия ERCC1 становится выше, опухоль растет медленнее, но польза от лечения цисплатином также меньше (рис. 5f).

    В клинических испытаниях пациенты с низкой / отрицательной экспрессией ERCC1 имели бы худший прогноз, если бы их не лечили, и они могли бы получить больше пользы от лечения цисплатином. С лечением их прогноз улучшается, но является ли он лучше, чем прогноз для пациентов с высоким / положительным ERCC1, не определено и зависит от исследуемой популяции, поэтому мы увидели противоречивые выводы исследования.

    Фотоактивируемая рекомбиназа Cre 3.0 для мышей in vivo

    Конструирование плазмиды

    Конструкции плазмидной ДНК были созданы с использованием стандартных методов с рестрикционными ферментами (New England BioLabs), ДНК-лигазой (MightMix, TaKaRa) и полимеразной цепной реакцией (ПЦР) с Phusion полимераза (Thermo-Fisher). Вектор временной экспрессии pcDNA3.1 (Life Technologies) использовался с промотором CMV, а вектор LV-SD лентивирусного вектора (Addgene, # 12105, LV-Cre-SD, больше не доступен в настоящее время) был использован в качестве вектора, опосредованного промотором CAG. .Опосредованный промотором CMV PA-Cre на основе магнитов был разработан в нашем предыдущем исследовании 10 . Мы синтезировали кодон-модифицированные последовательности CreN59, nMag и NLS (Integrated DNA Technologies, IDT) и вставили в сайты Nhe I / BamH I вместо исходных кодонных последовательностей без какой-либо аминокислотной замены. Вектор CRY2 / CIB1 был любезно подарен доктором К. Такером (Университет Колорадо). Для конструирования плазмиды PA-Cre на основе iLID / SspB синтезировали полноразмерную конструкцию PA-Cre на основе iLID / SspB и вставляли сайты Nhe I / Xba I pcDNA3.1 вектор. Для создания векторов FKF1 / GI мы использовали вектор pcDNA3-NLS-Gal4DBD-NLOV (h205L) -HA и pcDNA3-FLAG-GI-VP16 (ref. 13 ) в качестве векторов скелета. Мы вырезали Gal4DBD и вставляли NLS-CreN59 в сайты Kpn I / Not I pcDNA3-NLS-Gal4DBD-NLOV (h205L) -HA. Мы вырезали VP16 и вставляли CreC60 в сайты Not I / Xba I вектора pcDNA3-FLAG-GI-VP16. Для создания плазмиды CreERT2 мы использовали pCAG-CreERT2 (Addgene, # 14797) в качестве матрицы ПЦР и вставили последовательность CreERT2 в сайты EcoR I / Not I pcDNA 3.1 вектор. Для конструирования мутанта P2A и F2A мы использовали CMV-опосредованный Magnets на основе PA-Cre 10 в качестве каркасного вектора и вставили синтезированные конструкции в сайты BamH I / Xho I. Для создания CMV-опосредованных версий PA-Cre IRES на основе Magnets-Magnets-opti мы использовали версию на основе CRY2 / CIB1, названную PA-Cre 2.0 (ref. 11 ), в качестве шаблона ПЦР для последовательностей IRES и вставили Последовательность IRES в сайтах BamH, I / Xho, I каждого вектора вместо последовательности P2A.Чтобы построить CAG-опосредованные векторы Magnets, Magnets-IRES, Magnets-opti и Magnets-opti-IRES, мы вырезаем части Magnets, Magnets-IRES, Magnets-opti и Magnets-opti-IRES из CMV-Magnets, CMV- Магниты-IRES, CMV-Magnets-opti и CMV-Magnets-opti-IRES соответственно. Затем мы вставили каждый в сайты Nhe I / Xba I вектора LV-SD, который содержит домашние сайты множественного клонирования (MCS), EcoR I- Asc I- Nhe I- Pac I — Xba I- Xho I, вместо EcoR I-NLS-Cre- Xho I.Для создания вектора AAV-PA-Cre 3.0 мы использовали pRAM-d2TTA-TRE-MCS-WPRE-pA (Addgene # 63931) в качестве основного вектора. Мы вставили последовательность версии Magnets-opti (PA-Cre 3.0) в сайты Nhe I / Asc I и удалили последовательности WPRE, чтобы сохранить емкость упаковки AAV. Чтобы сконструировать вектор нацеливания мыши, мы использовали STOP-eGFP-ROSA26TV (Addgene, # 11739) в качестве основного вектора. Мы субклонировали последовательность промотора CAG_FRT_TKneo-polyA_FRT_ loxP _Magnets-opti_WPRE-polyA_ loxP _Kozak-NLS-mKate2-STOP и использовали ее в качестве целевого вектора «все-в-одном» (названный, эмбриональный клон мыши с положительной эмбриональной клеткой. ).Мы также субклонировали последовательность CAG Promoter_FRT_TKneo-polyA_FRT_Magnets-opti и использовали ее в качестве вектора нацеливания (названного B4). Для создания CMV-Magnets-HA, CMV-Magnets-opti-HA, CMV-Magnets-opti-IRES-HA, CAG-Magnets-HA и CAG-Magnets-opti-HA мы синтезировали HA-tag; НА, 5′-GCTGGCTCCTACCCATACGATGTTCCAGATTACGCT-3 ‘и вставленный на карбоксильный конец каждого вектора, соответственно.

    Животные

    Эксперименты с использованием мышей проводили в соответствии с Руководством по уходу и использованию лабораторных животных, изложенным IACUC Колумбийского университета.Мышь Rosa26 Ai14 / Ai14 (B6.Cg-Gt (ROSA) 26Sor tm14 (CAG-tdTomato) Hze / J; The Jackson Laboratory, Stock no: 007914) была приобретена в Лаборатории Джексона и скрестили с мышами C57BL / 6, чтобы получить Rosa26 Ai14 / WT . Rosa26 Ai14 / WT мышей умерщвляли для инъекции HTV в возрасте 5-6 недель, а также использовали для выделения MEF на E11.5-13.5 и использовали для выделения клеток-предшественников нейронов (NPC) на E12.5. Для создания химерных мышей PA-Cre мы создали линии эмбриональных стволовых клеток мыши (mESC) (A20 и B4) с интеграцией Magnets-opti в локус Rosa26 . Инъекция mESC в бластоцисты для получения химерных мышей была проведена в учреждении для трансгенных животных в Медицинском центре Колумбийского университета. Химерных мышей PA-Cre скрещивали с мышами C57BL / 6 и подтверждали передачу по зародышевой линии с помощью ПЦР генотипирования. Поколения F1, F2 и F3, названные Rosa26 PA-Cre A20 или PA-Cre B4 / WT , сохраняются путем скрещивания с мышами C57BL / 6.Мыши Rosa26 PA-Cre B4 / WT были скрещены с мышами Rosa26 Ai14 / Ai14 для получения Rosa26 PA-CreB4 / Ai14 . Rosa26 PA-CreB4 / Ai14 мышей, которых использовали для инъекции HTV в возрасте 5–6 недель, а также умерщвляли для выделения MEF на E11,5–13,5. Мышей Rosa26 PA-Cre A20 / WT использовали для выделения кортикальных нейронов на P1-4.Мыши Rosa26 PA-Cre A20 / WT были скрещены с мышами Rosa26 FLPe / FLPe (B6.129S4- Gt (ROSA) 26Sor tm) / RainJ, JAX # 009086) для создания Rosa26 PA-Cre A20 / FLPe . Rosa26 PA-Cre A20 / FLPe мышей, используемых для выделения MEF на E11.5–14.5.

    Культура клеток

    Эмбриональная почка человека (HEK) Клетки 293T (ATCC, # CRL-3216) культивировали в среде Eagle, модифицированной Дульбекко (DMEM, Thermo-Fisher) с добавлением 1% GlutaMax I (Thermo-Fisher) и 100 ед. / мл пенициллина и 100 мкг / мл стрептомицина (P.S., Thermo-Fisher) и 10% фетальной телячьей сыворотки (FBS, не инактивированный нагреванием, HyClone, Thermo-Fisher). Клетки HEK 293T пассировали с использованием 0,05% трипсина + 0,03% раствора EDTA (Thermo-Fisher). mESC, полученные от гибридных мышей C57BL / 6 и 129SV / EV (компания Columbia Transgenic Mouse, Chyuan-Sheng Lin) культивировали на фидерных клетках DR4, обработанных митомицином C. Клетки поддерживали DMEM (Thermo-Fisher) с добавлением 20% FBS, заменимых аминокислот (NEAA, Thermo-Fisher), 1% GlutaMax I, 1% нуклеозидов (Millipore-Sigma, ES-008-D) и 2- меркаптоэтанол (Sigma-Aldrich).Направляющий вектор электропорировали в недифференцированные mESC. Через 24 часа после электропорации среду заменяли средой для отбора, содержащей 50 мкг / мл G418 (Clontech), в течение 7 дней, чтобы установить нацеленные линии mESC. Интеграцию целевой плазмиды подтверждали с помощью ПЦР со следующими праймерами: 5 ‘GGACTAGGGCTGCGTGAGTCTCTGA (прямой) и GGCGTTACTATGGGAACATACGTC (обратный). Нацеленные mESC использовали для создания химерных мышей. Клетки MEF выделяли от E11.5 до E13.5 эмбрионов мыши с использованием 0,25% раствора трипсина-ЭДТА (Thermo-Fisher) и раствора ДНКазы (Worthington). Клетки MEF культивировали в среде DMEM с добавлением 10% FBS, 1% GlutaMax I и P.S. Клетки MEF пассировали с использованием 0,25% трипсина + 0,03% EDTA. NPC выделяли из мозга эмбрионов мышей E12.5 и диссоциировали с помощью аккутазы (Thermo-Fisher) и раствора ДНКазы Ι (Stem Cell Technologies). NPC пролиферировали с помощью среды нейральной индукции, ее добавки и среды Advanced DMEM / F12 (обе от Thermo-Fisher), а затем дифференцировали в нейроны средой Neurobasal Plus (Thermo-Fisher) с добавлением B27 (Thermo-Fisher), BDNF (PeproTech). ), NT3 (PeproTech), 1% GlutaMax I и P.S. Кортикальные нейроны выделяли от мышей P1-P4 с использованием раствора папаина, гибернации А и ДНКазы. Клетки собирали на чашке, покрытой PDL / ламинином, с нейробазальной средой, B27 и 1% FBS. На следующий день среду заменили на среду Neurobasal с добавлением B27, 1% GlutaMax I, HEPES (все, Thermo-Fisher) и P.S. Все клетки культивировали в условиях нормоксии (20% O 2 , 5% CO 2 , при 37 ° C) с использованием инкубатора HERAcell CO 2 / O 2 (Thermo-Fisher).

    Люциферазный анализ

    Клетки HEK 293T высевали из расчета 0,5 × 10 5 клеток / лунку в 24-луночные планшеты (Corning), покрытые полиорнитином (Sigma-Aldrich). На следующий день клетки трансфицировали кДНК, кодирующими PA-Cre вместе с репортером Firefly Luc и Renilla Luc с использованием реагента X-treameGENE9 (Sigma-Aldrich). Стандартное соотношение трансфекции PA-Cre: double-flox-инвертированный-FLuc: HSV-TK-Renilla Luc было следующим: 1: 9: 0,1. Затем клетки подвергали воздействию синего света (всего 12 часов, цикл 20 секунд света / 60 секунд, самодельное устройство 13 ) через 36 часов после трансфекции при 37 ° C в инкубаторе CO 2 (Thermo-Fisher).В случае Mock или CreERT2, обработанных тамоксифеном, клетки обрабатывали 1 мкМ тамоксифена (Sigma-Aldrich) через 36 часов после трансфекции. Уровни активности Luc определяли сразу после прекращения освещения с использованием набора для анализа двойной люциферазы и 96-луночного люминометра Veritas (Promega) в соответствии с инструкциями производителя.

    Флуоресцентная визуализация

    Клетки HEK 293T помещали на 2 × 10 5 клеток / чашку в чашку со стеклянным дном 3,5 см (MatTek), покрытую полиорнитином. На следующий день клетки трансфицировали кДНК, кодирующими PA-Cre, вместе с репортером Floxed-mCherry с использованием реагента X-treameGENE9.Стандартное соотношение трансфекции — PA-Cre и Floxed-mCherry в соотношении 1: 9. Затем клетки подвергали воздействию синего света (всего 12 часов, цикл 20 секунд света / 60 секунд, самодельное устройство) через 36 часов после трансфекции при 37 ° C в инкубаторе CO 2 . Клетки были визуализированы с помощью фильтров TxRed и Nikon NIS с использованием специального микроскопа Nikon Ti-E сразу после завершения освещения. Эффективность рекомбинации Cre- loxP анализировали с помощью программного обеспечения ImageJ (NIH) по красным флуоресцентным сигналам.Клетки MEF, NPC и нейроны коры также были визуализированы с помощью фильтров TxRed и Nikon NIS с использованием специального микроскопа Nikon Ti-E.

    Вестерн-блоттинг

    Образцы белка экстрагировали из клеток HEK 293T, трансфицированных каждой плазмидой (pcDNA3.1, Cre, CMV-Magnets, CMV-Magnets-F2A, мутант CMV-Magnets-P2A, CMV-Magnets-opti, CAG -Magnets, CAG-Magnets-opti, CMV-Magnets-HA, CMV-Magnets-opti-HA, CMV-Magnets-opti-IRES-HA, CAG-Magnets-HA и CAG-Magnets-opti-HA) с использованием экстракции буфер (50 мМ Трис-HCl (pH7.4), коктейли 150 мМ NaCl, 1% TritonX-100 и 1% ингибитора протеазы). Клетки хранили в темноте и собирали через 48 ч после трансфекции. Образцы помещали на лед на 30 мин для полной стабилизации. Лизат центрифугировали при 14000 об / мин в течение 10 минут при 4 ° C для удаления остатков клеток. Образцы супернатанта переносили в новые пробирки. Равный объем буфера для образца 2х додецилсульфата натрия (SDS) (8M мочевина, 40 мМ трис-HCl pH 7,4, 2% SDS, 10% 2-меркаптоэтанол и 0,01% бромфенолового синего) добавляли к образцам лизата и кипятить 5 мин на нагревательном блоке (~ 95 ° C).Образцы белка подвергали электрофорезу в SDS-полиакриламидном геле с использованием гелей на основе трис-глицина (Bio-Rad), содержащих 10% акриламид-бис (Fisher Scientific), а затем мембран из поливинилидендифторида (PVDF) с электропереносом с использованием XCell SureLock® Mini. -Cell и система блотов XCell ™ (Life Technologies). Мембраны были заблокированы 5% или 10% обезжиренным сухим молоком в TBS-T (солевой раствор на основе триса с твином, 50 мМ трис-HCl, 150 мМ NaCl и 0,1% твин) или 1% бычьим сывороточным альбумином (BSA). в TBS на ночь при 4 ° C или 1–4 ч при комнатной температуре (RT).Затем мембраны инкубировали со следующими первичными антителами: анти-Cre (Abcam, # ab24608, разведение 1: 1000 в растворе TBS-T с 5% BSA), анти-HA (Roche, # 11867423001, 1: 1000 в растворе TBS. с 1% BSA) и анти-β-тубулином (Sigma-Aldrich, # T5201, разведение 1: 8000 в растворе TBS-T с 5% BSA или в растворе TBS с 1% BSA) в течение 1 ч при комнатной температуре с последующим инкубация соответствующего вторичного антитела (Thermo-Fisher, Pierce, антитело против кролика, № 31460; антитело против мыши № 31430; антитело против крысы, № 31470, разведение 1: 8000 в TBS-T с 5% обезжиренным молоком или в растворе TBS. с 1% BSA) в течение 1 ч при комнатной температуре.Белковые сигналы детектировали с использованием субстрата для вестерн-блоттинга Pierce ECL (Thermo-Fisher) путем экспонирования на рентгеновских пленках (Thermo-Fisher) в темной комнате. Исходные кляксы также доступны в отсканированных изображениях пленки, представленных в файле дополнительных исходных данных.

    Количественная RT-PCR

    Образцы РНК экстрагировали из клеток HEK 293T, трансфицированных каждой плазмидой (pcDNA3.1, CMV-Magnets-HA, CMV-Magnets-opti-HA, CMV-Magnets-opti-IRES-HA, CAG-Magnets, CAG-Magnets-HA и CAG-Magnets-opti-HA) с использованием буфера RLT (Qiagen).Клетки хранили в темноте и собирали через 48 ч после трансфекции. РНК получали с использованием набора RNeasy Mini и набора ДНКаз, не содержащих РНКаз (Qiagen). кДНК синтезировали с использованием системы синтеза первой цепи SuperScript III для ОТ-ПЦР (Thermo-Fisher). КДНК (21 мкл) разбавляли водой, не содержащей ДНКаз (Thermo-Fisher) в соотношении 1: 4, и 1 мкл образцов использовали для анализа qPCR. Для количественной ПЦР использовали систему SYBR Advantage qPCR Premix (Clontech / TaKaRa Bio) и системы ПЦР в реальном времени StepOnePlus (Thermo-Fisher).Наборы праймеров для обнаружения транскриптов CreC60 и GAPDH были следующими: CreC60, прямой 5′-GAGATACCTGGCCTGGTCTGG-3 ‘, обратный 5′-ACATTGGTCCAGCCACCAGC-3′; GAPDH, прямой 5’-GATGACATCAAGAAGGTGGTGA-3 ‘, обратный 5′-GTCTACATGGCAACTGTGAGGA-3’ (олигосинтез, IDT). Значение CT каждого образца на 50% кривой амплификации использовали, и GAPDH использовали для нормализации экспрессии CreC60.

    Гидродинамическая инъекция в хвостовую вену

    Мы использовали 5-6-недельных мышей Rosa26 Ai14 / WT или Rosa26 PA-Cre B4 / Ai14 мышей.Мех с брюшной поверхности мышей удаляли с помощью ручного тримера. Мышей с удаленным мехом отдыхали в клетке не менее 24 часов и внутрибрюшинно вводили кДНК, кодирующие CAG-Magnets, CAG-Magnets-opti, Cre или pCAG-Flpe (Addgene, # 13787), используя TransIT®-EE Delivery. Раствор (ООО «Мирус Био») соответственно по протоколу производителя. Количество введенной ДНК составляло 10 мкг на мышь. Объем раствора для доставки составлял 0,1 мл на вес мыши (г). После гидродинамической инъекции ДНК мышей держали в темноте в течение 8 или 32 часов, а затем освещали светодиодным источником (470 ± 20 нм; 200 Вт / м 2 , CCS) в течение 16 часов в клетке.После освещения мышей выдерживали в темноте до выздоровления в течение 24 ч. Как и при естественном освещении, мышей содержали при стандартном белом флуоресцентном свете (0,05 Вт / м 2 ) в течение 48 или 72 часов. Мышей умерщвляли с использованием стандартной процедуры, одобренной в нашем протоколе для животных, и их печень немедленно собирали для флуоресцентной визуализации с помощью флуоресцентного стереоскопа (Zeiss).

    Лентивирусная инфекция in vitro

    Для получения лентивируса векторы LV-SD-Magnets, LV-SD-Magnets-opti, LV-SD-Flpe или LV-SD-YFP трансфицировали вместе с pCMV-dr8.2 dvpr (Addgene # 8455) и pCMV-VSV-G (Addgene # 8454) в клетки HEK 293T. Через сорок восемь и семьдесят два часа после трансфекции супернатанты культуральной среды собирали и концентрировали с использованием концентратора Lenti-X (TaKaRa) в соответствии с инструкциями производителя. Лентивирусную инфекцию MEF и кортикальных нейронных клеток проводили один или два раза, как показано в экспериментальных процедурах на фигурах. Освещение синим светом было начато через 24 ч после последнего заражения. На следующий день или через 2 дня после освещения репортерную экспрессию визуализировали и анализировали с использованием специального микроскопа Nikon Ti-E.

    Аденоассоциированная вирусная инфекция

    Производство аденоассоциированного вируса (AAV) было завершено в основном вирусологическом центре Колумбийского университета. Аденовирус 9,5 × 10 10 vg, инфицированный в нейроны, полученные из NPC, в чашке с пленочным дном диаметром 3,5 см (Matsunami). Через неделю после заражения 1 мкМ PMA (12-миристат-13-ацетат, Sigma-Aldrich) обрабатывали 24-часовым освещением синим светом. После обработки PMA 67 мМ KCl (Sigma-Aldrich) обрабатывали 6-часовым освещением синим светом (470 ± 20 нм, 1 Вт / м 2 , непрерывный, CCS).Флуоресцентные изображения были получены на следующий день после освещения синим светом с использованием указанного выше специализированного микроскопа Nikon. Самцам мышей C57BL / 6 J (возраст: 8-10 недель) вводили 200 нл смеси 50:50 AAV8-hSyn-DIO-mCherry (титр = 1,3 × 10 13 , Addgene) и AAV8-RAM-PA. -Cre (титр = 4,6 × 10 12 мкг / мл, ядро ​​Columbia Vector) в целевые области мозга мыши. Изготовленную волоконную оптику имплантировали на 200 мкм выше мест инъекции 22 . После операции мышей, инфицированных AAV8, либо переводили на доксициклиновую диету (200 мг / кг, Bioserv), либо на обычную диету, и давали им 3 недели для экспрессии белков, доставляемых вирусом.Синий свет (470 нм, 5–7 мВт) подавался по оптоволокну с частотой импульсов «2 с вкл. / 1 ​​с выкл.». Через три недели мышей удерживали с помощью стандартного ручного метода удерживания 23 . В частности, мышей помещали головой вперед в вентилируемую коническую пробирку объемом 50 мл и помещали в камеру с помощью поршня для ограничения движения на 1 час. Процедура ограничения была использована для индукции активации нейронов в целевой области мозга, что привело к увеличению c-fos + нейронов. Все тело мышей перфузировали и фиксировали 4% параформальдегидом в течение 1 ч сразу после прекращения ограничения, а затем мозг собирали для криосекции.Срезы миндалевидного тела окрашивали первичными антителами к c-fos (поликлональные антитела против кролика, Synaptic Systems, № по каталогу 226003) и mCherry (моноклональные антитела против крыс, 1: 500, Invitrogen № по каталогу 16D7) и вторичными антителами (козьими антителами против кроличьих антител Alexa. 488, кат. № A11008, козьи антитела против крыс, Alexa 568, Invitrogen, кат. № A11077), а также ядерное окрашивание Draq5 (5 мкМ, Thermo-Fisher Cat № 62254). Срезы спинного шва обрабатывали, как описано ранее 22 . Иммунофлуоресцентные изображения получали на конфокальном микроскопе Leica DMi8.

    Статистический анализ

    Статистическая значимость (значение P ), использованная для сравнения образцов с / без воздействия света, была определена с помощью теста F и двустороннего теста Стьюдента t (призма 7-8, GraphPad или Excel, Microsoft). Статистическая значимость сравнения множественных выборок была вычислена с использованием обычного одностороннего дисперсионного анализа с множественными сравнениями (призма 7-8). Точное значение p предоставляется в файле дополнительных исходных данных.

    Краткое изложение отчета

    Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этой статьей.

    Модель шинирования эксцизионной раны на мышах, включая приложения для трансплантации стволовых клеток.

  • 1

    Falanga, V. Заживление ран и их нарушение в диабетической стопе. Ланцет 366 , 1736–1743 (2005).

    Артикул

    Google ученый

  • 2

    Чыонг, К.М. Регенеративная биология: новые волосы из заживающих ран. Nature 447 , 265–266 (2007).

    CAS
    Статья

    Google ученый

  • 3

    Gurtner, G.C., Werner, S., Barrandon, Y. & Longaker, M.T. Ремонт и регенерация ран. Nature 453 , 314–321 (2008).

    CAS
    Статья

    Google ученый

  • 4

    Ву, Ю., Чжао, Р.C. & Tredget, E.E. Краткий обзор: стволовые клетки / клетки-предшественники костного мозга в восстановлении и регенерации кожи. Стволовые клетки 28 , 905–915 (2010).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 5

    Дэвидсон, Дж.М.Модели животных для заживления ран. Arch. Дерматол. Res. 290 доп. S1 – S11 (1998).

    Артикул

    Google ученый

  • 6

    Галиано, Р.Д., Майклс, Дж., Добрянский, М., Левин, Дж. П. и Гуртнер, Г. Количественная и воспроизводимая мышиная модель заживления эксцизионных ран. Round Repair Regen. 12 , 485–492 (2004).

    Артикул

    Google ученый

  • 7

    Ву, Ю., Чен, Л., Скотт, П.Г. & Tredget, E.E. Мезенхимальные стволовые клетки улучшают заживление ран за счет дифференцировки и ангиогенеза. Стволовые клетки 25 , 2648–2659 (2007).

    CAS
    Статья

    Google ученый

  • 8

    Michaels, J. et al. Мыши db / db демонстрируют серьезные нарушения заживления ран по сравнению с другими линиями мышей с диабетом в модели эксцизионной раны с силиконовыми шинами. Round Repair Regen. 15 , 665–670 (2007).

    Артикул

    Google ученый

  • 9

    Chen, L., Tredget, E.E., Wu, P.Y. И Ву, Ю.Паракринные факторы мезенхимальных стволовых клеток привлекают макрофаги и клетки эндотелиального происхождения и улучшают заживление ран. PLoS ONE 3 , e1886 (2008 г.).

    Артикул

    Google ученый

  • 10

    Chen, L., Tredget, E.E., Liu, C. & Wu, Y. Анализ аллогенности мезенхимальных стволовых клеток при приживлении и заживлении ран у мышей. PLoS ONE 4 , e7119 (2009 г.).

    Артикул

    Google ученый

  • 11

    Салливан Т.П., Иглштейн, У.Х., Дэвис, С.С. и Мерц, П. Свинья как модель заживления ран у человека. Round Repair Regen. 9 , 66–76 (2001).

    CAS
    Статья

    Google ученый

  • 12

    Орджилл Д. и Бланко К. Биоматериалы для лечения потери кожи (Woodhead Publishing, 2009).

  • 13

    Мартин П. Заживление ран — стремление к идеальной регенерации кожи. Science 276 , 75–81 (1997).

    CAS
    Статья

    Google ученый

  • 14

    Сингер, А.Дж. И Кларк, Р.А. Заживление кожных ран. N. Engl. J. Med. 341 , 738–746 (1999).

    CAS
    Статья

    Google ученый

  • 15

    Ip, J.E. et al. Мезенхимальные стволовые клетки используют интегрин β1, а не хемокиновый рецептор 4 CXC для миграции и приживления миокарда. Мол. Биол.Ячейка 18 , 2873–2882 (2007).

    CAS
    Статья

    Google ученый

  • 16

    Wu, Y. et al. Существенная роль ICAM-1 / CD18 в опосредовании набора EPC, ангиогенеза и восстановления инфаркта миокарда. Circ. Res. 99 , 315–322 (2006).

    CAS
    Статья

    Google ученый

  • 17

    Койн, Т.М., Маркус, А.Дж., Вудбери, Д.& Блэк, И. Стромальные клетки костного мозга, трансплантированные во взрослый мозг, отторгаются воспалительной реакцией и переносят донорские метки на нейроны и глию хозяина. Стволовые клетки 24 , 2483–2492 (2006).

    Артикул

    Google ученый

  • 18

    Bensaid, W. et al. Биоразлагаемый фибриновый каркас для трансплантации мезенхимальных стволовых клеток. Биоматериалы 24 , 2497–2502 (2003).

    CAS
    Статья

    Google ученый

  • 19

    Саха, К., Поллок, Дж. Ф., Шаффер, Д. В. И Хили, К. Разработка синтетических материалов для контроля фенотипа стволовых клеток. Curr. Opin. Chem. Биол. 11 , 381–387 (2007).

    CAS
    Статья

    Google ученый

  • 20

    Рустад, К.С. и другие. Повышение ангиогенной способности и стволовой способности мезенхимальных стволовых клеток за счет биомиметического гидрогелевого каркаса. Биоматериалы 33 , 80–90 (2012).

    CAS
    Статья

    Google ученый

  • 21

    Ли, Л.Ф., Цзян Т.Х., Гарнер В. и Чуонг К.М. Упрощенная процедура восстановления кожи, на которой появляются волосы. Tissue Eng. Часть C Методы 17 , 391–400 (2011).

    Артикул

    Google ученый

  • 22

    Peister, A. et al. Взрослые стволовые клетки костного мозга (МСК), выделенные из различных линий инбредных мышей, различаются по поверхностным эпитопам, скорости пролиферации и потенциалу дифференцировки. Кровь 103 , 1662–1668 (2004).

    CAS
    Статья

    Google ученый

  • 23

    Фасс И.Дж., Каноф М.Э., Смит П.Д. И Зола, Х. Выделение цельных мононуклеарных клеток из периферической крови и пуповинной крови. Curr. Protoc. Иммунол 85 , 7.1.1–7.1.8 (2009).

    Google ученый

  • 24

    Девайн, С.М. и другие. Мезенхимальные стволовые клетки способны проникать в костный мозг нечеловеческих приматов после системной инфузии. Exp. Гематол. 29 , 244–255 (2001).

    CAS
    Статья

    Google ученый

  • Что такое компьютерная мышь?

    Обновлено: 07.06.2021, Computer Hope

    Компьютерная мышь — это портативное аппаратное устройство ввода, которое управляет курсором в графическом интерфейсе пользователя (GUI) и может перемещать и выбирать текст, значки, файлы и папки на вашем компьютере.

    На настольных компьютерах мышь размещается на плоской поверхности (например, на плоской поверхности).g., коврик для мыши или стол) перед компьютером. На рисунке показан пример мыши настольного компьютера Logitech с двумя основными кнопками и колесиком.

    Кто изобрел мышь?

    Изначально мышь была известна как индикатор положения X-Y для системы отображения и была изобретена Дугласом Энгельбартом в 1963 году во время работы в Xerox PARC. Но из-за отсутствия успеха Alto первое широко используемое приложение мыши было на компьютере Apple Lisa. Сегодня это указывающее устройство есть практически на каждом компьютере.

    Для чего нужна мышь?

    Ниже приведен список всех функций и параметров компьютерной мыши, чтобы дать вам представление обо всех возможностях мыши.

    1. Перемещение курсора мыши — Основная функция заключается в перемещении указателя мыши по экрану.
    2. Point — После перемещения мыши вы можете указать на что-то другому пользователю или навести цифровой объект. Например, в игре вы можете использовать мышь, чтобы навести пистолет в том направлении, в котором нужно стрелять.
    3. Открыть или выполнить программу — После того, как вы переместили указатель на значок, папку или другой объект, щелчок или двойной щелчок по этому объекту открывает документ или запускает программу. Некоторые программы даже поддерживают тройное нажатие. См. Нашу страницу щелчка для получения дополнительной информации о щелчке мышью.
    4. Select — Мышь также позволяет выделить текст или файл или выделить и выбрать сразу несколько файлов.
    1. Перетаскивание — После того, как что-то выделено, его также можно переместить с помощью метода перетаскивания.
    2. Hover — перемещение курсора мыши над объектами с информацией о наведении помогает обнаружить функцию каждого объекта. Например, наведите указатель мыши на ссылку «навести курсор», чтобы увидеть пример.
    3. Прокрутка — При работе с длинным документом или просмотре длинной веб-страницы может потребоваться прокрутка вверх или вниз. Для прокрутки вращайте колесико мыши или перетаскивайте полосу прокрутки. Колесо мыши также можно использовать как кнопку. См. Страницу IntelliMouse для получения дополнительной информации и функций колесика мыши.
    4. Выполнение других функций — Многие настольные мыши также имеют кнопки, которые можно запрограммировать для выполнения любых функций. Например, у многих мышей есть две боковые кнопки на большой части мыши. Ближайшую к ладони кнопку можно запрограммировать для возврата к ранее просматриваемой веб-странице в браузере.

    Как мышь повысила удобство использования компьютера?

    При использовании компьютерной мыши вам не нужно запоминать команды, такие как те, которые используются в текстовой среде командной строки, такой как MS-DOS.Например, в MS-DOS вам нужно знать команду cd и команду dir и вводить команды на клавиатуре, чтобы открыть каталог (папку) и просмотреть его файлы. В то время как пользователю Windows нужно только дважды щелкнуть, чтобы открыть папку и увидеть ее содержимое.

    Виды компьютерных мышей

    Ниже приведен список всех типов компьютерных мышей и указывающих устройств, используемых с компьютером. Сегодня для настольных компьютеров наиболее распространенным типом мыши является оптическая мышь, которая подключается к порту USB и известна как мышь USB .Для портативных компьютеров наиболее распространенным типом мыши является тачпад.

    Порты для компьютерной мыши

    Сегодня большинство компьютерных мышей подключаются к компьютеру через порт USB. Ниже приведен список портов и беспроводных подключений, которые может использовать мышь.

    Из чего состоит компьютерная мышь?

    Компоненты компьютерной мыши могут различаться в зависимости от типа компьютерной мыши. Ниже приведен общий обзор компонентов большинства компьютерных мышей.

    Пуговицы

    Сегодня почти все компьютерные мыши имеют как минимум две кнопки, левую и правую кнопку для щелчка и управления объектами и текстом.Раньше были мыши только с одной кнопкой. Например, многие ранние компьютерные мыши Apple имели только одну кнопку.

    Шар, лазер или светодиод

    В настольной мыши используются шарик и ролики, если это механическая мышь, или лазер, или светодиод, если это оптическая мышь. Эти компоненты отслеживают движение мыши по оси x и оси y и перемещают курсор мыши по экрану. На картинке пример нижней части механической и оптической мыши.

    Колесо мыши

    Современные настольные компьютерные мыши также обычно имеют колесико мыши, которое позволяет прокручивать страницу вверх и вниз.

    Кончик

    Вместо того, чтобы катать колесо, если вы нажмете на колесо, его можно использовать как третью кнопку.

    Печатная плата

    Для передачи (ввода) всей информации о сигналах мыши, щелчках и другой информации мышь также должна иметь печатную плату с интегральными схемами.

    Кабельный или беспроводной приемник

    Для мыши с проводом в комплект входит кабель со штекером, который подключается к компьютеру. Сегодня большинство проводных мышей подключаются к USB-порту. Если на вашем компьютере есть беспроводная мышь, ему потребуется беспроводной USB-приемник, чтобы принимать беспроводной сигнал и вводить его в компьютер.

    Прочие детали

    Если вы используете портативный компьютер, некоторые из вышеупомянутых компонентов не требуются. Например, сенсорная панель не использует шар, лазер или светодиод для управления движением; он использует ваш палец на сенсорной панели. Другие части включают шарик для мышей с трекболом, дополнительные кнопки на стороне большого пальца мыши и выступы, используемые с мышками для портативных компьютеров.

    Что в ноутбуке используется для мыши?

    Поскольку ноутбук разработан для портативности, почти все современные ноутбуки используют тачпад в качестве мыши, а в некоторых ноутбуках Lenovo до сих пор используется TrackPoint.Кроме того, ко всем портативным компьютерам можно подключить проводную USB-мышь или беспроводную мышь. На картинке показан пример тачпада под клавиатурой ноутбука.

    Используются ли в смартфонах мышь?

    Смартфоны и планшеты используют сенсорный экран в качестве основного устройства ввода, поэтому ваш палец является мышью на этих устройствах. К большинству планшетов у вас также есть возможность подключить компьютерную мышь и использовать ее на планшете.

    Какой рукой управлять мышью?

    По умолчанию компьютерная мышь настроена на использование правой рукой.Однако, если вы левша, его можно настроить для использования левой рукой.

    Примечание

    Несмотря на то, что мышь можно настроить для левой руки, некоторые мыши предназначены для использования правой рукой, поэтому левой рукой может быть неудобно.

    Как я могу использовать или попрактиковаться в использовании мыши?

    На следующей странице объясняются основы работы с мышью, как она держится, как ее подключать и как она используется на компьютере. На странице представлены интерактивные примеры, которые помогают попрактиковаться в использовании различных функций мыши.

    Как заменить батарейки в мышке?

    Чтобы заменить батарейки в мыши, сдвиньте нижнюю крышку назад, замените старые батарейки, а затем замените крышку.

    Мышь против мышей или мышей

    Когда говорят об одном (единственном числе), компьютерную мышь называют «мышью». Говоря о двух или более (множественное число), называйте их «мышами» (предпочтительно) или «мышами».

    Кончик

    Чтобы избежать путаницы, некоторые компании и авторы избегают использования любой формы множественного числа от «мыши», называя несколько мышей «устройствами мыши».«

    «Мышь» — это аббревиатура?

    Нет. Некоторые считают, что «мышь» — это сокращение от «управляемое вручную оборудование, выбираемое пользователем». Однако, когда Дуглас Энгельбарт помог изобрести мышь, он назвал ее мышью, потому что устройство напоминало грызуна.

    Щелчок, Двойной щелчок, Условия оборудования, Устройство ввода, IntelliMouse, J-Mouse, Microsoft, Коврик для мыши, Картофельная мышь, Термины мыши, Указывающее устройство, Щелчок правой кнопкой мыши, Последовательная мышь, Сенсорная панель, Трекбол, Колесная мышь

    .

    admin

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *